RegulonDB RegulonDB 10.9: Gene Sequence
galR gene sequence


Size: 1032        A: 230  T: 258  G: 281  C: 263

Fasta

 

>galR E. coli K12. Version NC_000913.3 GI:556503834
atggcgaccataaaggatgtagcccgactggcaggcgtttcagtcgccaccgtttcccgc
gtcattaataattcacccaaagccagcgaagcttcccggctggctgtgcatagtgcaatg
gagtctcttagctatcacccgaacgccaacgcccgtgcgctggcgcagcagaccactgaa
acggtcggtctggtcgttggtgatgtttccgatccgtttttcggtgcaatggtgaaagcg
gtcgaacaggtggcttatcacaccggtaattttttattgattggcaacggttaccacaac
gaacaaaaagagcgtcaggccattgagcaactgatccgccatcgctgtgctgcgttggtc
gtccatgccaaaatgatcccggatgctgatttagcctcattaatgaaacaaatgcccggt
atggtgctgatcaaccgtatcctgcctggctttgaaaaccgttgtattgctctggacgat
cgttacggtgcctggctggcaacgcgtcatttaattcagcaaggtcatacccgcattggt
tatctgtgctctaaccactctatttctgacgccgaagatcgtctgcaagggtattacgat
gcccttgctgaaagtggtattgcggccaatgaccggctggtgacatttggcgaaccagac
gaaagcggcggcgaacaggcaatgaccgagcttttgggacgaggaagaaatttcactgcg
gtagcctgttataacgattcaatggcggcgggtgcgatgggcgttctcaatgataatggt
attgatgtaccgggtgagatttcgttaattggctttgatgatgtgctggtgtcacgctat
gtgcgtccgcgcctgaccaccgtgcgttacccaatcgtgacgatggcgacccaggctgcc
gaactggctttggcgctggcggataatcgccctctcccggaaatcactaatgtctttagt
ccgacgctggtacgtcgtcattcagtgtcaactccgtcgctggaggcaagtcatcatgca
accagcgactaa
              
                            

Download fasta file
RegulonDB