RegulonDB RegulonDB 10.9: Gene Sequence
galS gene sequence


Size: 1041        A: 245  T: 250  G: 291  C: 255

Fasta

 

>galS E. coli K12. Version NC_000913.3 GI:556503834
atgatcaccattcgtgatgtagcgcgtcaggctggcgtctctgtggcaacggtttcccgg
gtgctcaataacagcacgctggtcagtgccgacacgcgtgaagcagtaatgaaagccgtg
agtgagctggattatcggccaaacgccaatgcccaggcgctggcaactcaggttagcgac
accattggcgtggtggtgatggacgtttctgatgcgtttttcggcgcgctggtaaaagcg
gtggatctggtcgctcagcagcatcagaaatacgtgctaatcggcaatagctatcatgaa
gcggaaaaagagcgtcacgccattgaggtgttaattcgccagcgttgtaatgcgttgatt
gttcactcaaaagcattgagtgacgatgaactggcgcaatttatggataacattcccggt
atggtgttaatcaaccgcgttgtgccggggtacgcccatcgttgcgtttgcctggataat
ctcagcggtgcccgaatggcgacgcgcatgttgctgaataacggtcatcaacgtattggt
tatctttcttccagccacggcattgaagatgacgccatgcgtaaagcaggctggatgagt
gcgttgaaagagcaggatattattccgccggaaagctggattggcgctggtacgccggac
atgccgggcggtgaggcggcgatggttgaactgctggggcgcaatctacaacttaccgct
gtatttgcttataacgacaatatggccgctggcgcactgacagcattaaaagataatggc
attgcgattccgttacatctctcaatcatcggtttcgatgatattcccatcgcccgttac
accgacccgcaattaacgaccgtgcgttatcccattgcttcaatggcgaaattagccacc
gaactggccttgcagggggcagcaggcaatattgatcctcgtgccagccactgttttatg
ccgacgttagtgcgtcgccattctgtcgcaacacgccagaatgcggcggcgatcactaac
tcaacaaatcaggcgatgtaa
              
                            

Download fasta file
RegulonDB