RegulonDB RegulonDB 10.9: Gene Sequence
gcd gene sequence


Size: 2391        A: 524  T: 542  G: 674  C: 651

Fasta

 

>gcd E. coli K12. Version NC_000913.3 GI:556503834
atggcaattaacaatacaggctcgcgacgattactcgtcacgctaacagccctttttgca
gcgctttgcgggctgtatctactcattggcggaggctggctggtcgcgattggcggctcc
tggtactaccctatcgctggccttgtgatgctcggcgtcgcctggatgctgtggcgcagt
aaacgcgccgcgctttggctatacgcagccctgctgctcggcaccatgatttggggcgtc
tgggaagttggtttcgacttctgggcgctgactccgcgcagcgacattctggtcttcttc
ggcatctggctgatcctgccgtttgtctggcgtcgcctggtcattcctgccagcggcgca
gttgccgcactggtggtcgcactgctgattagcggtggtatcctgacctgggccggattt
aacgatccgcaggagatcaacggcaccttaagcgccgatgccacacctgctgaagctatc
tcccccgtagccgatcaggactggcctgcctatggtcgtaatcaggaaggtcaacgcttt
tcgccgctgaaacaaattaacgccgataacgtccataatctgaaagaagcctgggtgttc
cgtactggcgatgtgaagcagccgaacgatccgggtgaaatcaccaatgaagtgacgccg
attaaagtgggcgacaccctttacctgtgtaccgctcaccagcgcctgtttgcgcttgat
gccgccagcggcaaagagaaatggcattacgatcctgagctgaaaaccaacgagtctttc
cagcacgtaacctgccgtggtgtctcttatcatgaagccaaagcagaaaccgcttcgccg
gaagtgatggcggattgcccgcgtcgtatcattcttccggtcaatgatggtcgactgatt
gcgattaacgctgaaaacggcaaactgtgcgaaaccttcgccaataaaggcgtgctcaat
ctgcaaagcaatatgccagacaccaaaccgggtctgtatgaaccgacttcgccaccgatt
atcaccgataaaaccatcgtgatggccggttcagttaccgataacttctcaacccgcgaa
acgtctggcgtgatccgtggttttgatgtcaacaccggggagctgctgtgggcttttgat
cccggcgcgaaagatccgaacgcaatcccgtctgacgaacacacctttacctttaactcg
ccaaactcctgggcaccagcggcctatgacgcgaagctggatctggtctatctgccgatg
ggcgtgaccacgccggatatctggggcggtaaccgcacaccggaacaggaacgttatgcc
agctcgattctggcgctgaatgccactaccgggaaactggcgtggagctaccagaccgtt
caccacgacctgtgggacatggatcttccggcacagccgacgctggcggacatcaccgtt
aatggtcagaaagtgccagttatttacgctccggcgaaaaccggcaacatttttgtgctc
gatcgtcgtaatggcgaactggtggttccggcaccggaaaaaccggttccccaaggtgca
gcgaaaggcgattacgtaaccccaactcaaccgttttctgaactgagcttccgtccgacg
aaagatttgagcggtgcggatatgtggggagccaccatgtttgaccaactggtgtgccgc
gtgatgttccaccagatgcgctatgaaggcattttcaccccgccatctgaacagggtacg
ctggtcttcccgggtaacctggggatgttcgaatggggcgggatttccgttgatccaaat
cgtgaagtggcgattgccaacccaatggcactgccgtttgtttcgaaactgatcccgcgt
ggtcctggcaacccgatggagcagccgaaagatgccaaaggcacgggtacggaatccggc
attcagccacagtacggtgtaccgtatggtgtcacgctcaacccgttcctctcaccattt
ggtctgccatgtaaacagccagcatggggttatatctcggcgctggatctgaaaactaat
gaagtggtgtggaagaaacgtattggtacgccgcaggacagtatgccgttcccgatgccg
gttccggtgccgttcaatatgggtatgccgatgctgggcgggccaatctccacggcgggt
aacgtgctgtttatcgccgctacggcagataactacctgcgcgcttacaacatgagcaac
ggtgaaaaactgtggcagggtcgtttaccagcgggtggtcaggctacgccaatgacctat
gaagtgaatggtaagcagtatgtggtgatctccgcaggcggtcacggttcatttggtacg
aagatgggcgactatattgtggcttatgcgctgccggatgatgtgaagtaa
              
                            

Download fasta file
RegulonDB