RegulonDB RegulonDB 10.9: Gene Sequence
gdhA gene sequence


Size: 1344        A: 318  T: 310  G: 379  C: 337

Fasta

 

>gdhA E. coli K12. Version NC_000913.3 GI:556503834
atggatcagacatattctctggagtcattcctcaaccatgtccaaaagcgcgacccgaat
caaaccgagttcgcgcaagccgttcgtgaagtaatgaccacactctggccttttcttgaa
caaaatccaaaatatcgccagatgtcattactggagcgtctggttgaaccggagcgcgtg
atccagtttcgcgtggtatgggttgatgatcgcaaccagatacaggtcaaccgtgcatgg
cgtgtgcagttcagctctgccatcggcccgtacaaaggcggtatgcgcttccatccgtca
gttaacctttccattctcaaattcctcggctttgaacaaaccttcaaaaatgccctgact
actctgccgatgggcggtggtaaaggcggcagcgatttcgatccgaaaggaaaaagcgaa
ggtgaagtgatgcgtttttgccaggcgctgatgactgaactgtatcgccacctgggcgcg
gataccgacgttccggcaggtgatatcggggttggtggtcgtgaagtcggctttatggcg
gggatgatgaaaaagctctccaacaataccgcctgcgtcttcaccggtaagggcctttca
tttggcggcagtcttattcgcccggaagctaccggctacggtctggtttatttcacagaa
gcaatgctaaaacgccacggtatgggttttgaagggatgcgcgtttccgtttctggctcc
ggcaacgtcgcccagtacgctatcgaaaaagcgatggaatttggtgctcgtgtgatcact
gcgtcagactccagcggcactgtagttgatgaaagcggattcacgaaagagaaactggca
cgtcttatcgaaatcaaagccagccgcgatggtcgagtggcagattacgccaaagaattt
ggtctggtctatctcgaaggccaacagccgtggtctctaccggttgatatcgccctgcct
tgcgccacccagaatgaactggatgttgacgccgcgcatcagcttatcgctaatggcgtt
aaagccgtcgccgaaggggcaaatatgccgaccaccatcgaagcgactgaactgttccag
caggcaggcgtactatttgcaccgggtaaagcggctaatgctggtggcgtcgctacatcg
ggcctggaaatggcacaaaacgctgcgcgcctgggctggaaagccgagaaagttgacgca
cgtttgcatcacatcatgctggatatccaccatgcctgtgttgagcatggtggtgaaggt
gagcaaaccaactacgtgcagggcgcgaacattgccggttttgtgaaggttgccgatgcg
atgctggcgcagggtgtgatttaa
              
                            

Download fasta file
RegulonDB