RegulonDB RegulonDB 10.9: Gene Sequence
mokC gene sequence


Size: 210        A: 56  T: 46  G: 60  C: 48

Fasta

 

>mokC E. coli K12. Version NC_000913.3 GI:556503834
atgctgaacacatgtagagtgcctcttactgaccgtaaggtcaaggagaagagagcaatg
aagcagcataaggcgatgattgtcgccctgatcgtcatctgtatcaccgccgtagtggcg
gcgctggtaacgagaaaagacctctgtgaggttcacatccgaactggccagacggaggtt
gctgttttcacggcttacgaatccgagtaa
              
                            

Download fasta file
RegulonDB