RegulonDB RegulonDB 10.8: Gene Sequence
mnmG gene sequence


Size: 1890        A: 438  T: 424  G: 531  C: 497

Fasta

 

>mnmG E. coli K12. Version NC_000913.3 GI:556503834
atgttttatccggatccttttgacgtcatcatcattggcgggggtcatgcaggcaccgag
gccgcgatggccgcggcgcgtatgggtcaacagactctgcttttgacacacaatatcgac
actctggggcagatgagctgcaacccggcgatcggcggtattgggaagggacatctggta
aaagaagtggatgcactcggcggtctgatggcgaaagcgatcgatcaggcgggtatccag
tttaggatactaaacgcaagcaaaggaccggcggttcgcgctacccgagctcaggcggat
cgtgtgctctaccgtcaggcggtacgtacggcgctggagaaccaaccgaacctgatgatc
ttccagcaggcggttgaagatcttattgtcgaaaacgatcgcgtggtcggtgctgttacc
caaatgggactgaagttccgtgccaaagccgtcgtgctcaccgttgggacgttcctcgac
ggtaaaattcatatcggtctggataattacagcggtggccgtgctggtgatccgccgtcc
attccgctttctcgccgtttgcgtgaactgccgctgcgcgttggtcgtctgaaaaccggg
acaccaccgcgtattgatgctcgaaccatcgactttagcgtactggcgcaacagcatggc
gataacccaatgccggtattctcgtttatgggcaatgcgtcccagcatccccagcaggtg
ccgtgttatatcactcataccaacgagaaaacccatgatgtgatccgcagtaacctcgat
cgtagcccaatgtacgcaggggtgatcgaaggtgtcggcccacgctactgcccgtcgatc
gaagacaaagtcatgcgcttcgccgacagaaatcagcatcagatcttccttgaaccggaa
ggactgacctctaatgaaatttatccgaacggtatctccaccagcctgccgttcgatgtg
cagatgcaaatcgtccgctctatgcaggggatggaaaacgcgaagatcgtgcgtccgggt
tatgccattgagtatgacttcttcgatcctcgcgacctgaaaccgacgctggagagcaag
tttatccaggggctgttctttgctggtcagattaacggcactaccggttacgaagaagcc
gctgcgcaaggtttgctggccggtcttaacgctgcccgtctgtctgctgacaaagaaggt
tgggctccggcacgttctcaggcgtatctcggcgtactagttgatgacctgtgcacttta
ggaaccaaagaaccgtatcgtatgtttacttcgcgcgcagaatatcgtctgatgctacgc
gaagataatgcggatctgcgtttgactgaaatcggtcgtgaactgggcctggtggatgac
gaacgttgggcgcgctttaacgagaaacttgagaatatcgagcgtgagcgtcagcgtctg
aaatcgacctgggtaaccccgtcggcggaagctgcagccgaagtgaatgctcacctgact
gcgccgctttcccgtgaagccagtggtgaagatctgctgcgtcgtccggaaatgacttat
gaaaaattaaccacgctgacgccgtttgcccctgcgttgacagacgaacaggcggcggaa
caggttgagattcaggttaaatacgaaggttatatcgcgcgccagcaagatgagatcgaa
aagcagctgcgtaacgagaacaccctgctacccgcgacactggattaccgccaggtatcc
ggtctttctaacgaagtgatcgccaaacttaacgatcacaaaccagcctctatcggccaa
gcttcgcgtatttctggcgtcacgcctgcggccatctccattctgctggtgtggctgaaa
aaacagggtatgctgcgtcgtagcgcataa
              
                            

Download fasta file
RegulonDB