RegulonDB RegulonDB 10.10: Gene Sequence
glgA gene sequence


Size: 1434        A: 278  T: 368  G: 428  C: 360

Fasta

 

>glgA E. coli K12. Version NC_000913.3 GI:556503834
atgcaggttttacatgtatgttcagagatgttcccgctgcttaaaaccggcggtctggct
gatgttattggggcattacccgcagcacaaatcgcagacggcgttgacgctcgcgtactg
ttgcctgcatttcccgatattcgccgtggcgtgaccgatgcgcaggtagtatcccgtcgt
gataccttcgccggacatatcacgctgttgttcggtcattacaacggggttggcatttac
ctgattgacgcgccgcatctctatgatcgtccgggaagcccgtatcacgataccaactta
tttgcctataccgacaacgtattgcgttttgcgctgctggggtgggttggggcagaaatg
gccagcgggcttgacccattctggcgtcctgatgtggtgcatgcgcacgactggcatgca
ggccttgcgcctgcgtatctggcggcgcgcgggcgtccggcgaagtcggtgtttactgtg
cacaacctggcctatcaaggcatgttttatgcacatcacatgaatgacatccaattgcca
tggtcattctttaatattcatgggctggaattcaacggacaaatctctttcctgaaggcc
ggtctgtactatgccgatcacattacggcggtcagtccaacctacgctcgcgagatcacc
gaaccgcagtttgcctacggtatggaaggtctgttgcaacagcgtcaccgtgaagggcgt
ctttccggcgtactgaacggcgtggacgagaaaatctggagtccagagacggacttactg
ttggcctcgcgttacacccgcgatacgttggaagataaagcggaaaataagcgccagtta
caaatcgcaatggggcttaaggttgacgataaagtgccgctttttgcagtggtgagccgt
ctgaccagccagaaaggtctcgacctggtgctggaagccttaccgggtcttctggagcag
ggcgggcagctggcgctactcggcgcgggcgatccggtgctgcaggaaggtttccttgcg
gcggcagcggaataccccggtcaggtgggcgttcagattggctatcacgaagcattttcg
catcgcattatgggcggcgcggacgtcattctggtgcccagccgttttgaaccgtgcggc
ttaacgcaactttatggattgaagtacggtacgctgccgttagtgcggcgcaccggtggg
cttgctgatacggtttctgactgttctcttgagaaccttgcagatggcgtcgccagtggg
tttgtctttgaagatagtaatgcctggtcgctgttacgggctattcgacgtgcttttgta
ctgtggtcccgtccttcactgtggcggtttgtgcaacgtcaggctatggcaatggatttt
agctggcaggtcgcggcgaagtcgtaccgtgagctttactatcgcttgaaatag
              
                            

Download fasta file
RegulonDB