RegulonDB RegulonDB 11.1: Gene Sequence
glgB gene sequence


Size: 2187        A: 495  T: 527  G: 597  C: 568

Fasta

 

>glgB E. coli K12. Version NC_000913.3 GI:556503834
atgtccgatcgtatcgatagagacgtgattaacgcgctaattgcaggccattttgcggat
cctttttccgtactgggaatgcataaaaccaccgcgggactggaagtccgtgccctttta
cccgacgctaccgatgtgtgggtgattgaaccgaaaaccgggcgcaaactcgcaaaactg
gagtgtctcgactcacggggattctttagcggcgtcattccgcgacgtaagaattttttc
cgctatcagttggctgttgtctggcatggtcagcaaaacctgattgatgatccttaccgt
tttggtccgctaatccaggaaatggatgcctggctattatctgaaggtactcacctgcgc
ccgtatgaaaccttaggcgcgcatgcagatactatggatggcgtcacaggtacgcgtttc
tctgtctgggctccaaacgcccgtcgggtctcggtggttgggcaattcaactactgggac
ggtcgccgtcacccgatgcgcctgcgtaaagagagcggcatctgggaactgtttatccct
ggggcgcataacggtcagctctataaatacgagatgattgatgccaatggcaacttgcgt
ctgaagtccgacccttatgcctttgaagcgcaaatgcgcccggaaaccgcgtctcttatt
tgcgggctgccggaaaaggttgtacagactgaagagcgcaaaaaagcgaatcagtttgat
gcgccaatctctatttatgaagttcacctgggttcctggcgtcgccacaccgacaacaat
ttctggttgagctaccgcgagctggccgatcaactggtgccttatgctaaatggatgggc
tttacccacctcgaactactgcccattaacgagcatcccttcgatggcagttggggttat
cagccaaccggcctgtatgcgccaacccgccgttttggtactcgcgacgacttccgttat
ttcattgatgccgcacacgcagctggtctgaacgtgattctcgactgggtgccaggccac
ttcccgactgatgactttgcgcttgccgaatttgatggcacgaacttgtatgaacacagc
gatccgcgtgaaggctatcatcaggactggaacacgctgatctacaactatggtcgccgt
gaagtcagtaacttcctcgtcggtaacgcgctttactggattgaacgttttggtattgat
gcgctgcgcgtcgatgcggtggcgtcaatgatttatcgcgactacagccgtaaagagggg
gagtggatcccgaacgaatttggcgggcgcgagaatcttgaagcgattgaattcttgcgt
aataccaaccgtattcttggtgagcaggtttccggtgcggtgacaatggctgaggagtct
accgatttccctggcgtttctcgtccgcaggatatgggcggtctgggcttctggtacaag
tggaacctcggctggatgcatgacaccctggactacatgaagctcgacccggtttatcgt
cagtatcatcacgataaactgaccttcgggattctctacaactacactgaaaacttcgtc
ctgccgttgtcgcatgatgaagtggtccacggtaaaaaatcgattctcgaccgcatgccg
ggcgacgcatggcagaaattcgcgaacctgcgcgcctactatggctggatgtgggcattc
ccgggcaagaaactactgttcatgggtaacgaatttgcccagggccgcgagtggaaccat
gacgccagcctcgactggcatctgttggaaggcggcgataactggcaccacggtgtccag
cgtctggtgcgcgatctgaacctcacctaccgccaccataaagcaatgcatgaactggat
tttgacccgtacggctttgaatggctggtggtggatgacaaagaacgctcggtgctgatc
tttgtgcgtcgcgataaagagggtaacgaaatcatcgttgccagtaactttacgccggta
ccgcgtcatgattatcgcttcggcataaaccagccgggcaaatggcgtgaaatcctcaat
accgattccatgcactatcacggcagtaatgcaggcaatggcggcacggtacacagcgat
gagattgccagccacggtcgtcagcattcactaagcctgacgctaccaccgctggccact
atctggctggttcgggaggcagaatga
              
                            

Download fasta file
RegulonDB