RegulonDB RegulonDB 10.10: Gene Sequence
glgC gene sequence


Size: 1296        A: 308  T: 306  G: 353  C: 329

Fasta

 

>glgC E. coli K12. Version NC_000913.3 GI:556503834
atggttagtttagagaagaacgatcacttaatgttggcgcgccagctgccattgaaatct
gttgccctgatactggcgggaggacgtggtacccgcctgaaggatttaaccaataagcga
gcaaaaccggccgtacacttcggcggtaagttccgcattatcgactttgcgctgtctaac
tgcatcaactccgggatccgtcgtatgggcgtgatcacccagtaccagtcccacactctg
gtgcagcacattcagcgcggctggtcattcttcaatgaagaaatgaacgagtttgtcgat
ctgctgccagcacagcagagaatgaaaggggaaaactggtatcgcggcaccgcagatgcg
gtcacccaaaacctcgacattatccgccgttataaagcggaatacgtggtgatcctggcg
ggcgaccatatctacaagcaagactactcgcgtatgcttatcgatcacgtcgaaaaaggc
gcacgttgcaccgttgcttgtatgccagtaccgattgaagaagcctccgcatttggcgtt
atggcggttgatgagaacgataaaattatcgaattcgttgaaaaacctgctaacccgccg
tcaatgccgaacgatccgagcaaatctctggcgagtatgggtatctacgtctttgacgcc
gactatctgtatgaactgctggaagaagacgatcgcgatgagaactccagccacgacttt
ggcaaagatttgattcccaagatcaccgaagccggtctggcctatgcgcacccgttcccg
ctctcttgcgtacaatccgacccggatgccgagccgtactggcgcgatgtgggtacgctg
gaagcttactggaaagcgaacctcgatctggcctctgtggtgccggaactggatatgtac
gatcgcaattggccaattcgcacctacaatgaatcattaccgccagcgaaattcgtgcag
gatcgctccggtagccacgggatgacccttaactcactggtttccggcggttgtgtgatc
tccggttcggtggtggtgcagtccgttctgttctcgcgcgttcgcgtgaattcattctgc
aacattgattccgccgtattgttaccggaagtatgggtaggtcgctcgtgccgtctgcgc
cgctgcgtcatcgatcgtgcttgtgttattccggaaggcatggtgattggtgaaaacgca
gaggaagatgcacgtcgtttctatcgttcagaagaaggcatcgtgctggtaacgcgcgaa
atgctacggaagttagggcataaacaggagcgataa
              
                            

Download fasta file
RegulonDB