RegulonDB RegulonDB 10.10: Gene Sequence
glgP gene sequence


Size: 2448        A: 610  T: 590  G: 659  C: 589

Fasta

 

>glgP E. coli K12. Version NC_000913.3 GI:556503834
atgaatgctccgtttacatattcatcgcccacgcttagcgtagaagctcttaagcactct
atcgcttacaagctgatgtttacgattggaaaggacccggtcgtcgccaataaacatgaa
tggctgaacgcaacgttatttgctgtgcgcgatcgtctcgtggagcgctggttacgttca
aaccgtgcccagttgtcgcaagaaactcgtcaggtttactacctgtcgatggagtttttg
attggccgtacgctctccaacgccatgttgtcgctaggaatttacgaagatgtacagggc
gcactggaagcgatggggttaaatctcgaagagctgattgatgaagaaaatgacccaggc
ctcggtaacggtggcctgggacgtctggcggcttgcttccttgattctctggcgacgtta
gggttgccggggcgcggttacggcatccgctatgactacggtatgttcaagcagaacatc
gttaacggtagccagaaagagtcgccagactactggctggaatacggtaacccgtgggaa
ttcaaacgccacaacacgcgctataaagtccgttttggcggtcgcattcagcaggaaggt
aaaaaaacgcgctggattgaaaccgaagagattctgggagtcgcttacgatcagataatc
cctggttacgacaccgacgcgaccaacacgctgcgtttgtggagtgcgcaagccagtagc
gaaattaacctcggtaaattcaaccagggtgactacttcgcggcagtggaagataaaaac
cactccgagaacgtatctcgcgtactgtatccggatgactccacctactccgggcgtgag
ctgcgcctgcgtcaggaatacttcctggtttcctcgaccattcaggacattttaagccgc
cattatcagttgcataaaacctacgataacctggcggataaaatcgcgattcatctcaat
gatacccatccggtactgtcgattcctgagatgatgcgtctgctgatcgatgagcaccaa
tttagctgggacgacgcgtttgaggtgtgttgtcaggtcttctcctacactaaccacacg
ctgatgagcgaggcgctggaaacctggccggttgatatgctgggtaaaattctgccgcgt
cacctgcagatcatctttgaaatcaacgactatttcctgaaaaccttgcaggaacagtat
ccgaacgataccgatctgctgggacgggcgtcgatcattgatgaatccaacggtcgtcgt
gtgcgtatggcctggctggcggttgttgtgagccacaaagttaacggtgtatcggaactg
cactctaatctgatggtgcaatcgttgtttgccgactttgcgaaaatcttcccgggtcgt
ttcaccaacgtcaccaacggtgtgacgccgcgtcgctggctggcggtagcgaacccatcg
ctttcagccgtgctggacgaacacctgggccgtaactggcgcaccgaccttagcctgctt
aatgagctgcaacaacactgtgatttcccaatggttaatcacgctgtgcatcaggcgaag
ctggagaacaaaaagcgtctggcagagtatatcgcccagcagctgaatgtggtggtgaat
ccaaaggcgttgttcgatgtacaaatcaaacgtattcacgaatacaaacgtcaattgatg
aatgtgttgcatgtgattacccgctataaccgcatcaaggccgacccggatgcgaagtgg
gtaccgcgcgtgaatatttttggcggtaaggcggcttcggcctattacatggcgaagcac
attattcatttgatcaatgacgtagcgaaagtgatcaacaacgatccgcagattggcgat
aagctgaaagtcgtgttcatcccgaactacagcgttagcctggcgcagttgatcattccg
gcggcagatctgtctgaacagatttcgctggcagggacggaagcttccggcaccagtaac
atgaagtttgcgcttaacggtgcgctgactatcggtacgttggacggtgcgaatgtcgag
atgctggatcatgtcggtgctgacaatatctttatttttggtaacacagcggaagaagtg
gaagaactgcgtcgtcagggctacaaaccgcgtgaatactacgagaaagatgaggagctg
catcaggtgctgacgcaaatcggcagcggtgtattcagtccggaagatccgggtcgctat
cgcgatctggttgattcgctgatcaacttcggcgatcactaccaggtactggcggattat
cgcagctatgtcgattgtcaggataaagtcgatgaactctacgagcttcaggaagagtgg
accgcaaaagcgatgctgaacattgccaatatgggctacttctcttctgaccgtactatc
aaagagtacgccgatcatatctggcatatcgatccggtgagattgtaa
              
                            

Download fasta file
RegulonDB