RegulonDB RegulonDB 11.0: Gene Sequence
glnB gene sequence


Size: 339        A: 91  T: 75  G: 97  C: 76

Fasta

 

>glnB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagattgatgcgattataaaacccttcaagctggacgatgtccgcgaagcactg
gccgaagtcggtattaccggcatgacggtgaccgaagtgaaaggctttggtcgccagaaa
ggccataccgagctgtaccgcggcgcggagtatatggtggattttctgccgaaagtgaaa
attgagattgtcgtaccggacgacattgtcgatacctgtgtcgataccattattcgcacg
gcgcaaaccggcaaaatcggtgacggtaaaatcttcgtctttgacgtggcacgggtcatt
cgcatccgtaccggtgaagaggacgacgcggcaatttaa
              
                            

Download fasta file
RegulonDB