RegulonDB RegulonDB 10.10: Gene Sequence
glnG gene sequence


Size: 1410        A: 306  T: 301  G: 433  C: 370

Fasta

 

>glnG E. coli K12. Version NC_000913.3 GI:556503834
atgcaacgagggatagtctgggtagtcgatgacgatagttccatccgttgggtgcttgaa
cgtgcgctcgctggggcaggtttaacctgtacgacgtttgagaacggcgcagaagtgctg
gaggcgctggcgagcaaaacgccggatgtgctgctttcagatatccgtatgccgggaatg
gacgggctggcgctgctcaagcagattaaacagcgccatccaatgcttccggtcatcatt
atgaccgcacattccgatctggatgctgccgtcagcgcctatcaacaaggggcgtttgat
tatctgcccaaaccgtttgatatcgacgaagcagtggcgctggttgagcgcgctatcagt
cattaccaggaacagcagcagccgcgtaatgttcagcttaacggcccaacgaccgatatc
atcggcgaagcgccagccatgcaggacgtgttccgtattatcggtcggctttcgcgttct
tctattagcgtgctgattaacggcgaatccggcaccggtaaagaactggtcgctcatgcc
ctgcatcgccacagtccgcgcgccaaagcgccgtttatcgcgctgaatatggcagctatc
ccaaaagatttgatcgaatcagaactgtttggccacgagaaaggcgcgtttactggcgcg
aataccattcgtcaggggcgttttgaacaggccgatggcggtacattattcctcgacgaa
attggtgatatgccgctggatgtgcagacgcgtttgctgcgcgtgctggcagacggtcag
ttttaccgcgttggcggctatgcgccggtgaaagtggatgtgcggattatcgctgccact
caccagaatctcgaacagcgagtgcaggaaggtaagttccgtgaggatctgttccaccgc
ctgaacgttatccgcgttcatctgccgccgctgcgcgaacgtcgggaagatattccccgt
ctggcgcgccattttttacaggttgccgcgcgcgaactgggcgtagaagcgaagttactg
catccggaaaccgaagctgctctgacgcgtctggcgtggccaggcaacgtgcgccagctg
gaaaacacctgccgctggctaacggtgatggccgccgggcaggaagtgttgattcaggat
ttgcccggcgaactgtttgaatcaacggttgcggagagtacttcgcaaatgcaaccggac
agctgggcgacgcttcttgcgcagtgggcagacagagcgctgcgttccggtcatcaaaat
ctgctttccgaagcgcagccagagctggagcggacgttactgacgaccgcgttgcgacat
acgcaggggcataaacaggaagcggcgcggctactcggctggggccgcaacaccctgacg
cgtaagttaaaagagctggggatggagtga
              
                            

Download fasta file
RegulonDB