RegulonDB RegulonDB 10.9: Gene Sequence
glnH gene sequence


Size: 747        A: 216  T: 167  G: 192  C: 172

Fasta

 

>glnH E. coli K12. Version NC_000913.3 GI:556503834
atgaagtctgtattaaaagtttcactggctgcactgaccctggcttttgcggtttcttct
catgccgcggataaaaaattagttgtcgcgacggataccgccttcgttccgtttgaattt
aaacagggcgataaatatgtgggctttgacgttgatctgtgggctgccatcgctaaagag
ctgaagctggattacgaactgaagccgatggatttcagtgggatcattccggcactgcaa
accaaaaacgtcgatctggcgctggcgggcattaccatcaccgacgagcgtaaaaaagcg
atcgatttctctgacggctactacaaaagcggcctgttagtgatggtgaaagctaacaat
aacgatgtgaaaagcgtgaaagatctcgacgggaaagtggttgctgtgaagagcggtact
ggctccgttgattacgcgaaagcaaacatcaaaactaaagatctgcgtcagttcccgaac
atcgataacgcctatatggaactgggcaccaaccgcgcagacgccgttctgcacgatacg
ccaaacattctgtacttcatcaaaaccgccggtaacggtcagttcaaagcggtaggtgac
tctctggaagcgcagcaatacggtattgcgttcccgaaaggtagcgacgagctgcgtgac
aaagtcaacggcgcgttgaaaaccctgcgcgagaacggaacttacaacgaaatctacaaa
aaatggttcggtactgaaccgaaataa
              
                            

Download fasta file
RegulonDB