RegulonDB RegulonDB 10.10: Gene Sequence
glnL gene sequence


Size: 1050        A: 240  T: 230  G: 296  C: 284

Fasta

 

>glnL E. coli K12. Version NC_000913.3 GI:556503834
atggcaacaggcacgcagcccgatgctgggcagatcctcaactcgctgattaacagtatt
ttgttaatcgatgacaacctggcgatccattacgccaaccctgccgcgcaacaactgctc
gcccaaagctcccgcaaattgtttggtacaccgttaccggaactgttgagctacttctca
ttaaatatcgagctgatgcaagaaagtctggaggcggggcaaggttttaccgataacgaa
gtgacgctggtcatcgacgggcgctcgcatatcctttctgtgacggcccagcgtatgccg
gacggcatgatcctgctggagatggctccgatggataaccagcgccgcttaagtcaggaa
cagctacagcacgcccagcaggttgctgcccgtgatttagtgcgcggcctggcacatgag
attaaaaatccgcttggcggtttacgtggcgcggcgcagctgctcagcaaagcgttacct
gacccatcactactcgaatataccaaagtgattatcgaacaggcggaccggctgcgaaat
ctggtcgaccgtctgttggggccgcagctgcccggtacgcgcgttaccgaaagtattcac
aaagtggctgaacgcgtggtaacgctggtgtcgatggaactgccggacaacgtgcggttg
attcgtgattacgatcccagcctaccggaactggcgcacgacccggatcaaattgaacag
gtcttgctgaatattgtgcgcaatgcgctacaggcgctggggccggaaggcggtgaaatc
attctgcgtacccgcaccgcgtttcaactgaccttacacggcgagcgctaccggctggcg
gcgcggattgatgtggaagataacgggccgggcattccgcctcatttgcaggatacgctg
ttttacccgatggtcagcggccgcgaaggtggcaccgggcttggcttatccatcgctcgt
aatttgattgatcagcattcaggcaaaattgaatttaccagttggccagggcataccgag
ttctcggtttacctgcctatcaggaaataa
              
                            

Download fasta file
RegulonDB