RegulonDB RegulonDB 10.8: Gene Sequence
glnP gene sequence


Size: 660        A: 125  T: 182  G: 186  C: 167

Fasta

 

>glnP E. coli K12. Version NC_000913.3 GI:556503834
atgcagtttgactggagtgccatctggcctgccattccgcttctgattgaaggtgccaaa
atgaccctgtggatttcggtcctcggtctggcaggcggtctggtaatcggattgctggca
ggttttgcacgcaccttcggaggttggatagccaaccacgtcgcgctggtctttattgaa
gtgatccgcggcacacctatcgtcgtccaggtgatgtttatttatttcgccctgccgatg
gcgtttaacgacttacgcatcgacccatttactgcggcggtggtcaccatcatgatcaac
tccggcgcgtatattgcggaaatcacgcgtggtgcggtgctgtctatccacaaaggtttt
cgtgaagcaggactggcgctcggtctttcacgttgggaaaccattcgctacgtcatttta
ccgctggcactgcgtcgtatgctgccgccgctgggtaaccagtggatcatcagcattaaa
gacacctcgctgtttattgtgatcggcgtggcggaactgacccgtcaggggcaagaaatt
attgccggtaacttccgcgcccttgagatctggagcgccgtggcggtgttctatctgatt
attaccctggtgctgagctttattctgcgtcgtctggaaagaaggatgaaaatcctgtga
              
                            

Download fasta file
RegulonDB