RegulonDB RegulonDB 10.9: Gene Sequence
glnQ gene sequence


Size: 723        A: 173  T: 160  G: 209  C: 181

Fasta

 

>glnQ E. coli K12. Version NC_000913.3 GI:556503834
gtgattgaatttaaaaacgtctccaagcactttggcccaacccaggtgctgcacaatatc
gatttgaacattgcccagggcgaagtcgtggtgattatcgggccgtccggttccggtaaa
tcgaccctgctgcgctgcatcaacaaactggaagaaatcacctccggcgatctgattgtc
gatggcctgaaggttaacgatccgaaagttgacgagcgcctgattcgccaggaagcaggt
atggtgttccagcagttttacctcttcccgcatctgacagcgctggaaaacgtcatgttt
ggcccgctacgcgtgcgtggcgcgaacaaagaagaggcggaaaaactggcacgtgagctg
ctggcgaaagtcggtctggcagaacgtgcacatcactacccttccgaactttctggtggt
caacagcagcgtgtggcgattgcccgcgcgctggcggtgaagccgaaaatgatgctgttt
gatgaaccgacttccgctcttgacccggaactgcgccatgaagtgctgaaggttatgcag
gatctggctgaagaagggatgacgatggtgatcgtgacccacgaaatcggttttgccgag
aaagtagcttcgcggctgatctttatcgacaaaggccggattgcggaagatggcaatccg
caggtgttgatcaagaacccgccgagccagcgcttgcaggaatttttgcagcacgtctct
taa
              
                            

Download fasta file
RegulonDB