RegulonDB RegulonDB 10.9: Gene Sequence
gltA gene sequence


Size: 1284        A: 313  T: 320  G: 316  C: 335

Fasta

 

>gltA E. coli K12. Version NC_000913.3 GI:556503834
atggctgatacaaaagcaaaactcaccctcaacggggatacagctgttgaactggatgtg
ctgaaaggcacgctgggtcaagatgttattgatatccgtactctcggttcaaaaggtgtg
ttcacctttgacccaggcttcacttcaaccgcatcctgcgaatctaaaattacttttatt
gatggtgatgaaggtattttgctgcaccgcggtttcccgatcgatcagctggcgaccgat
tctaactacctggaagtttgttacatcctgctgaatggtgaaaaaccgactcaggaacag
tatgacgaatttaaaactacggtgacccgtcataccatgatccacgagcagattacccgt
ctgttccatgctttccgtcgcgactcgcatccaatggcagtcatgtgtggtattaccggc
gcgctggcggcgttctatcacgactcgctggatgttaacaatcctcgtcaccgtgaaatt
gccgcgttccgcctgctgtcgaaaatgccgaccatggccgcgatgtgttacaagtattcc
attggtcagccatttgtttacccgcgcaacgatctctcctacgccggtaacttcctgaat
atgatgttctccacgccgtgcgaaccgtatgaagttaatccgattctggaacgtgctatg
gaccgtattctgatcctgcacgctgaccatgaacagaacgcctctacctccaccgtgcgt
accgctggctcttcgggtgcgaacccgtttgcctgtatcgcagcaggtattgcttcactg
tggggacctgcgcacggcggtgctaacgaagcggcgctgaaaatgctggaagaaatcagc
tccgttaaacacattccggaatttgttcgtcgtgcgaaagacaaaaatgattctttccgc
ctgatgggcttcggtcaccgcgtgtacaaaaattacgacccgcgcgccaccgtaatgcgt
gaaacctgccatgaagtgctgaaagagctgggcacgaaggatgacctgctggaagtggct
atggagctggaaaacatcgcgctgaacgacccgtactttatcgagaagaaactgtacccg
aacgtcgatttctactctggtatcatcctgaaagcgatgggtattccgtcttccatgttc
accgtcattttcgcaatggcacgtaccgttggctggatcgcccactggagcgaaatgcac
agtgacggtatgaagattgcccgtccgcgtcagctgtatacaggatatgaaaaacgcgac
tttaaaagcgatatcaagcgttaa
              
                            

Download fasta file
RegulonDB