RegulonDB RegulonDB 10.9: Gene Sequence
gltD gene sequence


Size: 1419        A: 337  T: 285  G: 432  C: 365

Fasta

 

>gltD E. coli K12. Version NC_000913.3 GI:556503834
atgagtcagaatgtttatcaatttatcgacctgcagcgcgttgatccgccaaagaaaccg
ctgaagatccgcaaaattgagtttgttgaaatttacgagccgttttccgaaggccaggcc
aaagcgcaggctgaccgctgcctgtcgtgcggcaacccatactgcgagtggaaatgcccg
gtacacaactacatcccgaactggctgaagctcgccaacgaggggcgtatttttgaagcg
gcggaactgtcgcaccagaccaacaccctgccggaagtttgcggacgagtctgcccgcaa
gaccgtctgtgcgaaggttcctgcactctgaacgatgagtttggcgcggtgaccatcggc
aacattgagcgctatatcaacgataaagcgttcgagatgggctggcgtccggatatgtct
ggtgtgaaacagaccggtaaaaaagtggcgattatcggcgcaggcccggcaggtctggcg
tgtgcggatgtcctgacgcgtaacggcgtaaaagccgttgtcttcgaccgtcatccagaa
attggcgggctgctgaccttcggtattccggccttcaagctggaaaaagaggtaatgacg
cgtcgccgtgaaatcttcaccggcatgggtattgaattcaaactcaataccgaagtgggc
cgcgacgtacagctggacgatctgctgagtgattacgatgccgtgttccttggcgtcggg
acttatcagtcaatgcgcggcgggctggaaaacgaagacgccgatggcgtgtacgcagcg
ctgccgttcctcatcgccaacaccaaacagttaatgggctttggtgaaacccgcgacgaa
ccgttcgtcagcatggaaggcaaacgcgtggtggtccttggcggtggcgacactgcgatg
gactgcgtgcgtacgtccgtgcgccagggagcgaagcacgttacctgtgcctatcgtcgt
gatgaagagaacatgccgggttcccgccgcgaagtgaaaaacgcgcgggaagaaggcgta
gagttcaaattcaacgtccagccgctgggtattgaagtgaacggtaacggcaaagtcagc
ggcgtaaaaatggtgcgtaccgaaatgggcgaaccggacgccaaaggccgtcgccgcgcg
gagatcgttgcaggttccgaacatatcgttccggcagatgcggtgatcatggcgtttggt
ttccgtccacacaacatggaatggctggcaaaacacagcgtcgagctggattcacaaggc
cgcatcatcgccccggaaggcagcgacaacgccttccagaccagcaacccgaaaatcttt
gctggcggcgatatcgtccgtggttccgatctggtggtgaccgctattgccgaaggtcgt
aaggcggcagacggtattatgaactggctggaagtttaa
              
                            

Download fasta file
RegulonDB