RegulonDB RegulonDB 10.8: Gene Sequence
gltX gene sequence


Size: 1416        A: 349  T: 323  G: 390  C: 354

Fasta

 

>gltX E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcaaaactcgcttcgcgccaagcccaacaggctatctgcacgttggcggcgcg
cgtactgctctttactcctggctttttgcacgtaaccacggcggtgagttcgtgctgcgt
attgaagacaccgatcttgagcgttccacgccggaagctatcgaagccattatggatggc
atgaactggctgagcctggagtgggatgaaggtccgtactaccagaccaaacgttttgat
cgctacaacgcggtgatcgatcagatgctggaagagggcactgcttataaatgctattgc
tctaaagagcgcctggaagcgctgcgcgaagagcaaatggcgaaaggtgagaagccgcgt
tatgacggtcgctgccgccacagccatgagcatcatgctgatgatgaaccgtgtgttgta
cgttttgctaacccgcaggaaggttctgttgtttttgacgatcagatccgtggtccgatc
gagttcagcaaccaggaactggacgatcttattatccgccgtaccgatggttccccaacc
tataacttctgtgtggttgtcgatgactgggatatggaaatcacccacgttatccgtggc
gaagaccatatcaacaacacgccacgccagatcaacattcttaaggccctgaaagcgccg
gtgccggtttacgcgcacgtttctatgatcaatggcgatgacggtaaaaaactgtccaaa
cgtcacggggcagtcagcgtaatgcagtatcgtgatgacggttatttgccagaagcactg
ctgaactatctggtgcgtctgggctggtcccacggcgatcaggaaatcttcactcgtgaa
gagatgatcaaatacttcactttgaatgccgtcagcaaatctgccagtgcgttcaacacc
gacaagctgctgtggctgaaccatcactacattaacgcgctgccgccggagtatgttgct
actcacttacagtggcacattgagcaggaaaatatcgatacccgtaacggcccgcagctg
gctgatctggtgaaactgctgggcgaacgctgcaagacgctgaaagagatggcacagagc
tgccgttatttctacgaagattttgctgagttcgatgccgacgccgcgaaaaaacatctg
cgtccggtagcgcgtcagccgctggaagtggttcgtgacaaactggccgcgattactgac
tggaccgctgaaaacgttcatcacgctattcaggcgacggcggatgagctggaagtgggt
atgggtaaagttggtatgccgctgcgtgtcgccgtaaccggtgcggggcagtctccagca
ctggatgttaccgttcacgcaattggtaagacccgcagtatcgagcgtatcaacaaagcg
ctggattttattgctgaacgcgaaaatcagcagtaa
              
                            

Download fasta file
RegulonDB