RegulonDB RegulonDB 10.10: Gene Sequence
gnd gene sequence


Size: 1407        A: 353  T: 348  G: 364  C: 342

Fasta

 

>gnd E. coli K12. Version NC_000913.3 GI:556503834
atgtccaagcaacagatcggcgtagtcggtatggcagtgatgggacgcaaccttgcgctc
aacatcgaaagccgtggttataccgtctctattttcaaccgttcccgtgagaagacggaa
gaagtgattgccgaaaatccaggcaagaaactggttccttactatacggtgaaagagttt
gtcgaatctctggaaacgcctcgtcgcatcctgttaatggtgaaagcaggtgcaggcacg
gatgctgctattgattccctcaaaccatatctcgataaaggagacatcatcattgatggt
ggtaacaccttcttccaggacactattcgtcgtaatcgtgagctttcagcagagggcttt
aacttcatcggtaccggtgtttctggcggtgaagagggggcgctgaaaggtccttctatt
atgcctggtggccagaaagaagcctatgaattggtagcaccgatcctgaccaaaatcgcc
gccgtagctgaagacggtgaaccatgcgttacctatattggtgccgatggcgcaggtcac
tatgtgaagatggttcacaacggtattgaatacggcgatatgcagctgattgctgaagcc
tattctctgcttaaaggtggcctgaacctcaccaacgaagaactggcgcagacctttacc
gagtggaataacggtgaactgagcagttacctgatcgacatcaccaaagatatcttcacc
aaaaaagatgaagacggtaactacctggttgatgtgatcctggatgaagcggctaacaaa
ggtaccggtaaatggaccagccagagcgcgctggatctcggcgaaccgctgtcgctgatt
accgagtctgtgtttgcacgttatatctcttctctgaaagatcagcgtgttgccgcatct
aaagttctctctggtccgcaagcacagccagcaggcgacaaggctgagttcatcgaaaaa
gttcgtcgtgcgctgtatctgggcaaaatcgtttcttacgcccagggcttctctcagctg
cgtgctgcgtctgaagagtacaactgggatctgaactacggcgaaatcgcgaagattttc
cgtgctggctgcatcatccgtgcgcagttcctgcagaaaatcaccgatgcttatgccgaa
aatccacagatcgctaacctgttgctggctccgtacttcaagcaaattgccgatgactac
cagcaggcgctgcgtgatgtcgttgcttatgcagtacagaacggtattccggttccgacc
ttctccgcagcggttgcctattacgacagctaccgtgctgctgttctgcctgcgaacctg
atccaggcacagcgtgactattttggtgcgcatacttataagcgtattgataaagaaggt
gtgttccataccgaatggctggattaa
              
                            

Download fasta file
RegulonDB