RegulonDB RegulonDB 10.9: Gene Sequence
gpt gene sequence


Size: 459        A: 107  T: 114  G: 127  C: 111

Fasta

 

>gpt E. coli K12. Version NC_000913.3 GI:556503834
atgagcgaaaaatacatcgtcacctgggacatgttgcagatccatgcacgtaaactcgca
agccgactgatgccttctgaacaatggaaaggcattattgccgtaagccgtggcggtctg
gtaccgggtgcgttactggcgcgtgaactgggtattcgtcatgtcgataccgtttgtatt
tccagctacgatcacgacaaccagcgcgagcttaaagtgctgaaacgcgcagaaggcgat
ggcgaaggcttcatcgttattgatgacctggtggataccggtggtactgcggttgcgatt
cgtgaaatgtatccaaaagcgcactttgtcaccatcttcgcaaaaccggctggtcgtccg
ctggttgatgactatgttgttgatatcccgcaagatacctggattgaacagccgtgggat
atgggcgtcgtattcgtcccgccaatctccggtcgctaa
              
                            

Download fasta file
RegulonDB