RegulonDB RegulonDB 10.9: Gene Sequence
grpE gene sequence


Size: 594        A: 166  T: 129  G: 178  C: 121

Fasta

 

>grpE E. coli K12. Version NC_000913.3 GI:556503834
atgagtagtaaagaacagaaaacgcctgaggggcaagccccggaagaaattatcatggat
cagcacgaagagattgaggcagttgagccagaagcttctgctgagcaggtggatccgcgc
gatgaaaaagttgcgaatctcgaagctcagctggctgaagcccagacccgtgaacgtgac
ggcattttgcgtgtaaaagccgaaatggaaaacctgcgtcgtcgtactgaactggatatt
gaaaaagcccacaaattcgcgctggagaaattcatcaacgaattgctgccggtgattgat
agcctggatcgtgcgctggaagtggctgataaagctaacccggatatgtctgcgatggtt
gaaggcattgagctgacgctgaagtcgatgctggatgttgtgcgtaagtttggcgttgaa
gtgatcgccgaaactaacgtcccactggacccgaatgtgcatcaggccatcgcaatggtg
gaatctgatgacgttgcgccaggtaacgtactgggcattatgcagaagggttatacgctg
aatggtcgtacgattcgtgcggcgatggttactgtagcgaaagcaaaagcttaa
              
                            

Download fasta file
RegulonDB