RegulonDB RegulonDB 10.9: Gene Sequence
grxA gene sequence


Size: 258        A: 75  T: 67  G: 67  C: 49

Fasta

 

>grxA E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaccgttatttttggtcgttcgggttgcccttactgtgtgcgtgcaaaagatctg
gctgagaaattgagcaatgaacgcgatgattttcagtatcagtatgtagatattcgtgcg
gaagggatcactaaagaagatctacaacaaaaggcaggtaaacccgtagaaaccgtgccg
cagatttttgtcgatcagcaacatatcggcggctataccgattttgctgcatgggtgaaa
gaaaatctggacgcctga
              
                            

Download fasta file
RegulonDB