RegulonDB RegulonDB 10.9: Gene Sequence
gshA gene sequence


Size: 1557        A: 380  T: 378  G: 429  C: 370

Fasta

 

>gshA E. coli K12. Version NC_000913.3 GI:556503834
ttgatcccggacgtatcacaggcgctggcctggctggaaaaacatcctcaggcgttaaag
gggatacagcgtgggctggagcgcgaaactttgcgtgttaatgctgatggcacactggca
acaacaggtcatcctgaagcattaggttccgcactgacgcacaaatggattactaccgat
tttgcggaagcattgctggaattcattacaccagtggatggtgatattgaacatatgctg
acctttatgcgcgatctgcatcgttatacggcgcgcaatatgggcgatgagcggatgtgg
ccgttaagtatgccatgctacatcgcagaaggtcaggacatcgaactggcacagtacggc
acttctaacaccggacgctttaaaacgctgtatcgtgaagggctgaaaaatcgctacggc
gcgctgatgcaaaccatttccggcgtgcactacaatttctctttgccaatggcattctgg
caagcgaagtgcggtgatatctcgggcgctgatgccaaagagaaaatttctgcgggctat
ttccgcgttatccgcaattactatcgtttcggttgggtcattccttatctgtttggtgca
tctccggcgatttgttcttctttcctgcaaggaaaaccaacgtcgctgccgtttgagaaa
accgagtgcggtatgtattacctgccgtatgcgacctctcttcgtttgagcgatctcggc
tataccaataaatcgcaaagcaatcttggtattaccttcaacgatctttacgagtacgta
gcgggccttaaacaggcaatcaaaacgccatcggaagagtacgcgaagattggtattgag
aaagacggtaagaggctgcaaatcaacagcaacgtgttgcagattgaaaacgaactgtac
gcgccgattcgtccaaaacgcgttacccgcagcggcgagtcgccttctgatgcgctgtta
cgtggcggcattgaatatattgaagtgcgttcgctggacatcaacccgttctcgccgatt
ggtgtagatgaacagcaggtgcgattcctcgacctgtttatggtctggtgtgcgctggct
gatgcaccggaaatgagcagtagcgaacttgcctgtacacgcgttaactggaaccgggtg
atcctcgaaggtcgcaaaccgggtctgacgctgggtatcggctgcgaaaccgcacagttc
ccgttaccgcaggtgggtaaagatctgttccgcgatctgaaacgcgtcgcgcaaacgctg
gatagtattaacggcggcgaagcgtatcagaaagtgtgtgatgaactggttgcctgcttc
gataatcccgatctgactttctctgcccgtatcttaaggtctatgattgatactggtatt
ggcggaacaggcaaagcatttgcagaagcctaccgtaatctgctgcgtgaagagccgctg
gaaattctgcgcgaagaggattttgtagccgagcgcgaggcgtctgaacgccgtcagcag
gaaatggaagccgctgataccgaaccgtttgcggtgtggctggaaaaacacgcctga
              
                            

Download fasta file
RegulonDB