RegulonDB RegulonDB 10.9: Gene Sequence
guaA gene sequence


Size: 1578        A: 360  T: 364  G: 448  C: 406

Fasta

 

>guaA E. coli K12. Version NC_000913.3 GI:556503834
atgacggaaaacattcataagcatcgcatcctcattctggacttcggttctcagtacact
caactggttgcgcgccgcgtgcgtgagctgggtgtttactgcgaactgtgggcgtgggat
gtgacagaagcacaaattcgtgacttcaatccaagcggcattattctttccggcggcccg
gaaagtactactgaagaaaacagtccgcgtgcgccgcagtatgtctttgaagcaggcgta
ccggtattcggcgtttgctatggcatgcagaccatggcaatgcagttgggcggtcacgtt
gaagcctctaacgaacgtgaatttggctacgcgcaggttgaagtcgtaaacgacagcgca
ctggttcgcggtatcgaagatgcgctgaccgcagacggtaaaccgctgctcgatgtctgg
atgagccacggcgataaagttaccgctattccgtccgacttcatcaccgtagccagcacc
gaaagctgcccgtttgccattatggctaacgaagaaaaacgcttctatggcgtacagttc
cacccggaagtgactcatacccgccagggtatgcgcatgctggagcgttttgtgcgtgat
atctgccagtgtgaagccctgtggacgccagcgaaaattatcgacgatgctgtagctcgc
atccgcgagcaggtaggcgacgataaagtcatcctcggcctctctggtggtgtggattcc
tccgtaaccgcaatgctgctgcaccgcgctatcggtaaaaacctgacttgcgtattcgtc
gacaacggcctgctgcgcctcaacgaagcagagcaggttctggatatgtttggcgatcac
tttggtcttaacattgttcacgtaccggcagaagatcgcttcctgtcagcgctggctggc
gaaaacgatccggaagcaaaacgtaaaatcatcggtcgcgttttcgttgaagtattcgat
gaagaagcgctgaaactggaagacgtgaagtggctggcgcagggcaccatctaccctgac
gttatcgaatctgcggcgtctgcaaccggtaaagcacacgtcatcaaatctcaccacaac
gtgggcggcctgccgaaagagatgaagatgggcctggttgaaccgctgaaagagctgttc
aaagacgaagtgcgtaagattggtctggagctgggcctgccgtacgacatgctgtaccgt
cacccgttcccgggaccaggccttggcgttcgtgttctgggtgaagtgaagaaagagtac
tgtgacctgctgcgccgtgctgacgccatcttcattgaagaactgcgtaaagcggacctg
tacgacaaagtcagccaggcgttcactgtgttcctgccggtacgttccgttggcgtaatg
ggcgatggtcgtaagtatgactgggttgtctctctgcgtgctgtcgaaaccatcgacttt
atgaccgcacactgggcgcatctgccgtacgatttcctcggtcgcgtttccaaccgcatt
atcaatgaagtgaacggtatttcccgcgtggtgtatgacatcagcggcaagccgccagct
accattgagtgggaatga
              
                            

Download fasta file
RegulonDB