RegulonDB RegulonDB 10.9: Gene Sequence
guaB gene sequence


Size: 1467        A: 337  T: 328  G: 422  C: 380

Fasta

 

>guaB E. coli K12. Version NC_000913.3 GI:556503834
atgctacgtatcgctaaagaagctctgacgtttgacgacgttctcctcgttcctgctcac
tctaccgttctgccgaatactgctgacctcagcacccagctgacgaaaactattcgtctg
aatatccctatgctttccgcagcaatggataccgtaacggaagcgcgcctggctattgct
ctggctcaggaaggcggtatcggctttatccacaaaaacatgtccattgaacgccaggca
gaagaagttcgccgtgtgaaaaaacacgaatctggtgtggtgactgatccgcagactgtt
ctgccaaccacgacgctgcgcgaagtgaaagaactgaccgagcgtaacggttttgcgggc
tatccggtcgttaccgaagaaaacgaactggtgggtattatcaccggtcgtgacgtgcgt
tttgttaccgacctgaaccagccggttagcgtttacatgacgccgaaagagcgtctggtc
accgtgcgtgaaggtgaagcccgtgaagtggtgctggcaaaaatgcacgaaaaacgcgtt
gaaaaagcgctggtggttgatgacgaattccacctgatcggcatgatcaccgtgaaagac
ttccagaaagcggaacgtaaaccgaacgcctgtaaagacgagcaaggccgtctgcgtgtt
ggtgcagcggttggcgcaggtgcgggtaacgaagagcgtgttgacgcgctggttgccgca
ggcgttgacgttctgctgatcgactcctcccacggtcactcagaaggtgtactgcaacgt
atccgtgaaacccgtgctaaatatccggatctgcaaattatcggcggcaacgtggcaaca
gctgcaggtgcacgcgctctggcagaagctggttgcagtgcggttaaagtcggcattggc
cctggctctatctgtacaactcgtatcgtgactggcgtcggtgttccgcagattaccgct
gttgctgacgcagtagaagccctggaaggcaccggtattccggttatcgctgatggcggt
attcgcttctccggcgacatcgccaaagctatcgccgctggcgcaagcgcggtgatggta
ggttccatgctggcgggtactgaagaatctccgggtgaaatcgaactctaccagggccgt
tcttacaaatcttaccgtggtatgggttccctgggcgcgatgtccaaaggttcctctgac
cgttatttccagagcgataacgctgccgacaaactggtgccggaaggtatcgaaggtcgc
gtagcctataaaggtcgcctgaaagagatcattcaccagcagatgggcggcctgcgctcc
tgtatgggtctgaccggctgtggtactatcgacgaactgcgtactaaagcggagtttgta
cgtatcagcggtgcgggcattcaggaaagccacgttcacgacgtgaccattactaaagag
tccccgaactaccgtctgggctcctga
              
                            

Download fasta file
RegulonDB