RegulonDB RegulonDB 10.9: Gene Sequence
guaC gene sequence


Size: 1044        A: 243  T: 265  G: 289  C: 247

Fasta

 

>guaC E. coli K12. Version NC_000913.3 GI:556503834
atgcgtattgaagaagatctgaagttaggttttaaagacgttctcatccgccctaaacgc
tccactcttaaaagccgttccgatgttgaactggaacgtcaattcaccttcaaacattca
ggtcagagctggtccggcgtgccgattatcgccgcaaatatggacaccgtaggcacattt
tctatggcctctgcgctggcttcttttgatattttgactgctgtgcataaacactattct
gtcgaagagtggcaagcgtttatcaacaattcttccgctgatgtgctgaaacatgtgatg
gtttctaccggtacgtctgatgcggatttcgaaaaaactaaacagattctcgacctgaac
ccggcattaaacttcgtttgtattgacgtggcgaatggttattccgaacacttcgtgcag
ttcgttgcgaaagcgcgtgaagcgtggccgaccaaaaccatttgtgctggtaacgtagtg
actggtgaaatgtgtgaggagcttatcctctcaggtgccgatatcgttaaagttggcatt
ggcccaggttctgtttgtacaactcgcgtcaaaacaggcgtcggttatccgcaactttct
gcggtaatcgaatgtgccgatgctgcgcacggtctgggcggaatgatcgtcagcgatggt
ggctgcaccacgccgggcgatgtggcgaaagcctttggcggcggtgccgatttcgtcatg
cttggcggcatgctggcgggccacgaagagagcggcggtcgcatcgttgaggagaacggc
gagaaatttatgctgttctacggcatgagctccgagtctgcgatgaaacgtcacgttggc
ggcgttgcggaatatcgcgcagcagaaggtaaaaccgttaagctgccgctgcgaggcccg
gttgaaaataccgcgcgagatattttgggcggcctgcgttcagcttgtacatacgttggg
gcttcacgcctgaaagagctgaccaagcgcaccacgtttattcgtgtgcaggaacaagaa
aaccgcatcttcaacaacctgtaa
              
                            

Download fasta file
RegulonDB