RegulonDB RegulonDB 10.9: Gene Sequence
gyrB gene sequence


Size: 2415        A: 597  T: 490  G: 688  C: 640

Fasta

 

>gyrB E. coli K12. Version NC_000913.3 GI:556503834
atgtcgaattcttatgactcctccagtatcaaagtcctgaaagggctggatgcggtgcgt
aagcgcccgggtatgtatatcggcgacacggatgacggcaccggtctgcaccacatggta
ttcgaggtggtagataacgctatcgacgaagcgctcgcgggtcactgtaaagaaattatc
gtcaccattcacgccgataactctgtctctgtacaggatgacgggcgcggcattccgacc
ggtattcacccggaagagggcgtatcggcggcggaagtgatcatgaccgttctgcacgca
ggcggtaaatttgacgataactcctataaagtgtccggcggtctgcacggcgttggtgtt
tcggtagtaaacgccctgtcgcaaaaactggagctggttatccagcgcgagggtaaaatt
caccgtcagatctacgaacacggtgtaccgcaggccccgctggcggttaccggcgagact
gaaaaaaccggcaccatggtgcgtttctggcccagcctcgaaaccttcaccaatgtgacc
gagttcgaatatgaaattctggcgaaacgtctgcgtgagttgtcgttcctcaactccggc
gtttccattcgtctgcgcgacaagcgcgacggcaaagaagaccacttccactatgaaggc
ggcatcaaggcgttcgttgaatatctgaacaagaacaaaacgccgatccacccgaatatc
ttctacttctccactgaaaaagacggtattggcgtcgaagtggcgttgcagtggaacgat
ggcttccaggaaaacatctactgctttaccaacaacattccgcagcgtgacggcggtact
cacctggcaggcttccgtgcggcgatgacccgtaccctgaacgcctacatggacaaagaa
ggctacagcaaaaaagccaaagtcagcgccaccggtgacgatgcgcgtgaaggcctgatt
gcggtcgtttccgtgaaagtgccggacccgaaattctcctcccagaccaaagacaaactg
gtttcttctgaggtgaaatcggcggttgaacagcagatgaacgaactgctggcagaatac
ctgctggaaaacccaaccgacgcgaaaatcgtggttggcaaaattatcgatgctgcccgt
gcccgtgaagcggcgcgtcgcgcgcgtgaaatgacccgccgtaaaggtgcgctcgactta
gcgggcctgccgggcaaactggcagactgccaggaacgcgatccggcgctttccgaactg
tacctggtggaaggggactccgcgggcggctctgcgaagcaggggcgtaaccgcaagaac
caggcgattctgccgctgaagggtaaaatcctcaacgtcgagaaagcgcgcttcgataag
atgctctcttctcaggaagtggcgacgcttatcaccgcgcttggctgtggtatcggtcgt
gacgagtacaacccggacaaactgcgttatcacagcatcatcatcatgaccgatgcggac
gtcgacggctcgcacattcgtacgctgctgttgaccttcttctatcgtcagatgccggaa
atcgttgaacgcggtcacgtctacatcgctcagccgccgctgtacaaagtgaagaaaggc
aagcaggaacagtacattaaagacgacgaagcgatggatcagtaccagatctctatcgcg
ctggacggcgcaacgctgcacaccaacgccagtgcaccggcattggctggcgaagcgtta
gagaaactggtatctgagtacaacgcgacgcagaaaatgatcaatcgtatggagcgtcgt
tatccgaaagcaatgctgaaagagcttatctatcagccgacgttgacggaagctgacctt
tctgatgagcagaccgttacccgctgggtgaacgcgctggtcagcgaactgaacgacaaa
gaacagcacggcagccagtggaagtttgatgttcacaccaatgctgagcaaaacctgttc
gagccgattgttcgcgtgcgtacccacggtgtggatactgactatccgctggatcacgag
tttatcaccggtggcgaatatcgtcgtatctgcacgctgggtgagaaactgcgtggcttg
ctggaagaagatgcgtttatcgaacgtggcgagcgtcgtcagccggtagccagcttcgag
caggcgctggactggctggtgaaagagtcccgtcgcggcctctccatccagcgttataaa
ggtctgggcgagatgaacccggaacagctgtgggaaaccactatggacccggaaagtcgt
cgtatgctgcgcgttaccgttaaagatgcgattgctgccgaccagttgttcaccacgctg
atgggcgacgccgttgaaccgcgccgtgcgtttattgaagagaacgccctgaaagcggcg
aatatcgatatttaa
              
                            

Download fasta file
RegulonDB