RegulonDB RegulonDB 10.9: Gene Sequence
hdhA gene sequence


Size: 768        A: 206  T: 199  G: 192  C: 171

Fasta

 

>hdhA E. coli K12. Version NC_000913.3 GI:556503834
gtgtttaattctgacaacctgagactcgacggaaaatgcgccatcatcacaggtgcgggt
gcaggtattggtaaagaaatcgccattacattcgcgacagctggcgcatctgtggtggtc
agtgatattaacgccgacgcagctaaccatgttgtagacgaaattcaacaactgggtggt
caggcatttgcctgccgttgtgatattacttccgaacaggaactctctgcactggcagac
tttgctatcagtaagctgggtaaagttgatattctggttaacaacgccggtggcggtgga
cctaaaccgtttgatatgccaatggcggattttcgccgtgcttatgaactgaatgtgttt
tcttttttccatctgtcacaacttgttgcgccagaaatggaaaaaaatggcggtggcgtt
attctgaccatcacttctatggcggcagaaaataaaaatataaacatgacttcctatgca
tcatctaaagctgcggccagtcatctggtcagaaatatggcgtttgacctgggtgaaaaa
aatattcgggtaaatggcattgcgccgggggcaatattaaccgatgccctgaaatccgtt
attacaccagaaattgaacaaaaaatgttacagcacacgccgatcagacgtctgggccaa
ccgcaagatattgctaacgcagcgctgttcctttgctcgcctgctgcgagctgggtaagc
ggacaaattctcaccgtctccggtggtggggtacaggagctcaattaa
              
                            

Download fasta file
RegulonDB