RegulonDB RegulonDB 10.9: Gene Sequence
helD gene sequence


Size: 2055        A: 505  T: 460  G: 609  C: 481

Fasta

 

>helD E. coli K12. Version NC_000913.3 GI:556503834
atggaactgaaagcgacaacgcttggaaaacgtctggcacagcacccttacgatcgggcg
gtgatcctcaatgccgggattaaagtctccggcgatcgccacgaataccttattcctttc
aatcaattactggcgattcactgtaagcgcggtctggtatggggcgagctggaatttgta
ctgccggacgaaaaagtggtgcgtctgcacggcaccgaatggggcgagacgcagcgtttt
taccatcatcttgatgctcactggcggcggtggagtggcgagatgagcgaaattgcgtct
ggtgttttacgccagcaactggatttgattgccacgcgcactggggaaaataaatggctg
acgcgtgagcaaacctctggcgtgcagcaacaaatccgccaggctttgtcggcgttgccg
ttgccggttaaccgactggaagaattcgataactgccgtgaggcgtggcgtaaatgtcag
gcctggttgaaagatattgaaagcgctcggttgcagcataaccaggcgtataccgaagcc
atgcttaccgagtatgcggattttttccgccaggtcgagtcttcaccgctgaatccggcg
caggcccgggcagtcgttaatggcgagcattctctgttagtgctggcaggtgcaggaagc
ggaaaaacgtcggtgctggtggcccgtgcaggctggttgctggcgcgtggtgaagcgtcc
cctgagcaaattttattgctggcgtttggtcgcaaagccgctgaagagatggacgagcgg
attcgcgaacggctacataccgaagacattaccgcacgcacgtttcatgcgctggcgctg
catattattcagcagggcagcaaaaaagttccgatagtcagcaaactggaaaatgatacc
gctgcccgtcatgaactctttattgctgagtggcgcaagcaatgcagcgaaaagaaagcg
caggcgaagggctggcggcaatggctgacggaagaaatgcagtggtcagtgccagaaggt
aacttctgggatgatgaaaaattacagcgtcgccttgcctctcgcctcgatcgctgggta
agtctgatgcggatgcacggtggtgcacaggcagaaatgattgccagtgcacccgaagag
attcgcgatctgttcagtaaacgtatcaagttgatggccccgttattaaaagcctggaaa
ggtgcgctgaaggcagaaaacgctgtcgatttttcgggccttattcatcaggcgattgtg
attctggagaaaggtcgctttatcagcccgtggaagcatattctggttgatgaatttcag
gatatctcgccgcagcgggcagcgttgttagcggcattacgcaagcaaaacagtcagacg
acgttgttcgctgttggtgatgactggcaggcgatttaccgattcagcggtgcgcaaatg
tcgctcaccaccgctttccatgaaaactttggtgaaggcgaacgctgtgatttagacacg
acttaccgttttaacagtcgtatcggtgaggtggcaaaccggtttattcagcagaaccca
ggccagctgaaaaagccgctaaacagcttaaccaatggagacaaaaaagccgtcacgtta
ttggatgagagtcaacttgacgctttgctggataagctctctggttatgccaaaccggaa
gagcgcattctgatcctggcgcgttaccatcacatgaggcctgccagcctggaaaaagcg
gcaacacgctggccgaagttgcaaatcgactttatgaccattcatgccagcaaagggcaa
caggcggattacgtcatcatcgttggcttgcaggagggaagtgatggttttccggctgcg
gcgcgggagtcgattatggaagaggcgctactgccaccggttgaggatttcccggacgct
gaagaacggcggttaatgtacgtggcgctgacccgggcacgccatcgggtatgggcactg
tttaacaaagagaatccctctccctttgtggaaatactgaaaaatctggatgtgccggtg
gcgagaaaaccgtaa
              
                            

Download fasta file
RegulonDB