RegulonDB RegulonDB 10.9: Gene Sequence
hemB gene sequence


Size: 975        A: 225  T: 224  G: 282  C: 244

Fasta

 

>hemB E. coli K12. Version NC_000913.3 GI:556503834
atgacagacttaatccaacgccctcgtcgcctgcgcaaatctcctgcgctgcgcgctatg
tttgaagagacaacacttagccttaacgacctggtgttgccgatctttgttgaagaagaa
attgacgactacaaagccgttgaagccatgccaggcgtgatgcgcattccagagaaacat
ctggcacgcgaaattgaacgcatcgccaacgccggtattcgttccgtgatgacttttggc
atctctcaccataccgatgaaaccggcagcgatgcctggcgggaagatggactggtggcg
cgtatgtcgcgcatctgcaagcagaccgtgccagaaatgatcgttatgtcagacacctgc
ttctgtgaatacacttctcacggtcactgcggtgtgctgtgcgagcatggcgtcgacaac
gacgcgactctggaaaatttaggcaagcaagccgtggttgcagctgctgcaggtgcagac
ttcatcgccccttccgccgcgatggacggccaggtacaggcgattcgtcaggcgctggac
gctgcgggatttaaagatacggcgattatgtcgtattcgaccaagttcgcctcctccttt
tatggcccgttccgtgaagctgccggaagcgcattaaaaggcgaccgcaaaagctatcag
atgaacccaatgaaccgtcgtgaggcgattcgtgaatcactgctggatgaagcccagggc
gcagactgcctgatggttaaacctgctggagcgtacctcgacatcgtgcgtgagctgcgt
gaacgtactgaattgccgattggcgcgtatcaggtgagcggtgagtatgcgatgattaag
ttcgccgcgctggcgggtgctatagatgaagagaaagtcgtgctcgaaagcttaggttcg
attaagcgtgcgggtgcggatctgattttcagctactttgcgctggatttggctgagaag
aagattctgcgttaa
              
                            

Download fasta file
RegulonDB