RegulonDB RegulonDB 10.8: Gene Sequence
hemH gene sequence


Size: 963        A: 218  T: 226  G: 273  C: 246

Fasta

 

>hemH E. coli K12. Version NC_000913.3 GI:556503834
atgcgtcagactaaaaccggtatcctgctggcaaacctgggtacgcccgatgcccccaca
cctgaagcggtaaaacgctatctgaaacaatttttaagcgacagacgcgtggttgatacc
tcacggttgttatggtggccattgctgcgcggcgtgattttgccgctgcgctcgccgcgt
gtggcgaagctgtatgcctctgtctggatggaaggtggctcgccgctgatggtttacagc
cgccagcaacagcaggcgctggcacaacgtttaccggagatgcccgtagcgctgggaatg
agctacggctcgccatcactggaaagcgccgtagatgaactcctggcagagcatgtagat
catattgtggtgctgccgctttatccgcaattctcctgttctacggtcggtgcggtatgg
gatgaactggcacgcattctggcgcgcaaacgtagcattccggggatatcgtttatacgt
gattacgccgataaccacgattacattaatgcactggcgaacagcgtacgcgcttctttt
gccaaacatggcgaaccggatctgctactgctctcttatcatggcattccccagcgttat
gcagatgaaggcgatgattacccgcaacgttgccgcacaacgactcgtgaactggcttcc
gcattggggatggcaccggaaaaagtgatgatgacctttcagtcgcgctttggtcgggaa
ccctggctgatgccttataccgacgaaacgctgaaaatgctcggagaaaaaggcgtaggt
catattcaggtgatgtgcccgggctttgctgcggattgtctggagacgctggaagagatt
gccgagcaaaaccgtgaggtcttcctcggtgccggcgggaaaaaatatgaatatattccg
gcgcttaatgccacgccggaacatatcgaaatgatggctaatcttgttgccgcgtatcgc
taa
              
                            

Download fasta file
RegulonDB