RegulonDB RegulonDB 10.9: Gene Sequence
hemL gene sequence


Size: 1281        A: 263  T: 307  G: 387  C: 324

Fasta

 

>hemL E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagtctgaaaatctttacagcgcagcgcgcgagctgatccctggcggtgtgaac
tcccctgttcgcgcctttactggcgtgggcggcactccactgtttatcgaaaaagcggac
ggcgcttatctgtacgatgttgatggcaaagcctatatcgattatgtcggttcctggggg
ccgatggtgctgggccataaccatccggcaatccgcaatgccgtgattgaagccgccgag
cgtggtttaagctttggtgcaccaaccgaaatggaagtgaaaatggcgcaactggtgacc
gaactggtcccgaccatggatatggtgcgcatggtgaactccggcactgaagcgaccatg
agcgccatccgcctggcccgtggttttaccggtcgcgacaaaattattaaatttgaaggg
tgttaccatggtcacgctgactgcctgctggtgaaagccggttctggcgcactcacgtta
ggccagccaaactcgccgggcgttccggcagatttcgccaaatataccttaacctgtact
tataatgatctggcttctgtacgcgccgcatttgagcaatacccgcaagagattgcctgt
attatcgtcgagccggtggcaggcaatatgaactgtgttccgccgctgccagagttcctg
ccaggtctgcgcgcgctgtgcgacgaatttggcgcgttgctgatcatcgatgaagtgatg
accggtttccgcgtagcgctagctggcgcacaggattattacggcgtagtgccagattta
acctgcctcggcaaaatcatcggcggtggaatgccggtaggcgcattcggtggtcgtcgt
gatgtaatggatgcgctggccccgacgggtccggtctatcaggcgggtacgctttccggt
aacccgattgcgatggcagcgggtttcgcctgtctgaatgaagtcgcgcagccgggcgtt
cacgaaacgctggatgagctgacaacacgtctggcagaaggtctgctggaagcggcagaa
gaagccggaattccgctggtcgttaaccacgttggcggcatgttcggtattttctttacc
gacgccgagtccgtgacgtgctatcaggatgtgatggcctgtgacgtggaacgctttaag
cgtttcttccatatgatgctggacgaaggtgtttacctggcaccgtcagcgtttgaagcg
ggctttatgtccgtggcgcacagcatggaagatatcaataacaccatcgatgctgcacgt
cgggtgtttgcgaagttgtga
              
                            

Download fasta file
RegulonDB