RegulonDB RegulonDB 10.9: Gene Sequence
hha gene sequence


Size: 219        A: 72  T: 58  G: 41  C: 48

Fasta

 

>hha E. coli K12. Version NC_000913.3 GI:556503834
atgtccgaaaaacctttaacgaaaaccgattatttaatgcgtttacgtcgttgccagaca
attgacacgctggagcgtgttatcgagaaaaataaatacgaattatcagataatgaactg
gcggtattttactcagccgcagatcaccgcctcgccgaattgaccatgaataaactgtac
gacaagatcccttcctcagtatggaaatttattcgctaa
              
                            

Download fasta file
RegulonDB