RegulonDB RegulonDB 10.9: Gene Sequence
hipB gene sequence


Size: 267        A: 91  T: 57  G: 59  C: 60

Fasta

 

>hipB E. coli K12. Version NC_000913.3 GI:556503834
atgatgagctttcagaagatctatagcccaacgcaattggcgaatgcaatgaaactggtt
cgccagcaaaatggctggacgcagagcgagctggcgaaaaaaattggtattaagcaggcg
acgatttccaatttcgaaaacaaccctgacaataccacgctcacgacattttttaagatt
ttacagtcgcttgaactctcaatgacgctatgcgacgcgaaaaatgcctcgccagaatca
acagaacagcaaaatctggagtggtaa
              
                            

Download fasta file
RegulonDB