RegulonDB RegulonDB 10.9: Gene Sequence
hipA gene sequence


Size: 1323        A: 369  T: 318  G: 348  C: 288

Fasta

 

>hipA E. coli K12. Version NC_000913.3 GI:556503834
atgcctaaacttgtcacttggatgaacaaccagcgggtaggcgagttaacgaagttagcc
aacggcgcgcacacctttaagtatgcaccggagtggttagcaagccgttatgccagaccg
ttgtcactttcgctgccattgcagagggggaatatcacctctgatgccgtatttaacttc
ttcgataacctgttacccgatagcccgattgtacgtgaccggatcgttaaacgttatcat
gccaaatccagacaaccgtttgatttattgtcagaaatagggcgagacagcgttggtgcc
gtgacgttaatacccgaagacgaaaccgtaacgcatccgataatggcatgggaaaagctt
actgaagccagacttgaagaagtattaacggcttataaagcagatatcccgctaggcatg
attagagaagaaaatgactttcgcatctcggttgctggcgcacaggagaagacagcactg
ctcagaataggcaatgactggtgcattccgaaaggaataacgccgacgacgcacatcatt
aaattaccgattggcgaaatcaggcagcccaatgcgacgctcgatctcagccaaagcgtt
gataatgagtattactgtctgctgctggcgaaagaacttgggttgaatgttccggacgca
gaaatcattaaagcgggaaatgtgcgcgcgttagcggtcgaacgttttgacaggcgttgg
aatgctgagcgaacggttttacttcgcttgccacaggaggatatgtgtcagacattcggt
ttaccttcatcggtgaaatatgaatcagatggaggcccaggcatcgcgcggatcatggct
tttttgatggggtccagcgaggcgctgaaagatcgctatgattttatgaaattccaggtc
ttccagtggttgattggcgcaacggacggtcatgcaaaaaacttctccgtatttattcag
gctggcggcagttatcgactcacgccattttacgacatcatttcagcatttccggtcctt
ggcggtacgggaatacacatcagcgatctcaaactggcaatggggcttaacgcatccaaa
ggcaaaaaaacggcaatcgataaaatttatccgcgacattttttggcgacagcaaaggtg
ctgagattcccggaagtgcagatgcatgaaatcctgagtgactttgccagaatgattcca
gcagcactggataacgtgaagacttcattaccgacagattttccggagaacgtggtgacg
gcagttgaaagcaatgtgttgaggttgcatggacggttaagccgagaatacggtagtaag
tga
              
                            

Download fasta file
RegulonDB