RegulonDB RegulonDB 10.8: Gene Sequence
hisC gene sequence


Size: 1071        A: 249  T: 229  G: 297  C: 296

Fasta

 

>hisC E. coli K12. Version NC_000913.3 GI:556503834
atgagcaccgtgactattaccgatttagcgcgtgaaaacgtccgcaacctgacgccgtat
cagtcggcgcgtcgtctgggcggtaacggcgatgtctggctgaacgccaacgaatacccc
actgccgtggagtttcagcttactcagcaaacgctcaaccgctacccggaatgccagccg
aaagcggtgattgaaaattacgcgcaatatgcaggcgtaaaaccggagcaggtgctggtc
agccgtggcgcggacgaaggtattgaactgctgattcgcgctttttgcgaaccgggtaaa
gacgccatcctctactgcccgccaacgtacggcatgtacagcgtcagcgccgaaacgatt
ggcgtcgagtgccgcacagtgccgacgctggacaactggcaactggacttacagggcatt
tccgacaagctggacggcgtaaaagtggtttatgtttgcagccccaataacccgaccggg
caactgatcaatccgcaggattttcgcaccctgctggagttaacccgcggtaaggcgatt
gtggttgccgatgaagcctatatcgagttttgcccgcaggcatcgctggctggctggctg
gcggaatatccgcacctggctattttacgcacactgtcgaaagcttttgctctggcgggg
cttcgttgcggatttacgctggcaaacgaagaagtcatcaacctgctgatgaaagtgatc
gccccctacccgctctcgacgccggttgccgacattgcggcccaggcgttaagcccacag
ggaatcgtcgccatgcgcgaacgggtagcgcaaattattgcagaacgcgaatacctgatt
gccgcactgaaagagatcccctgcgtagagcaggttttcgactctgaaaccaactacatt
ctggcgcgctttaaagcctccagtgcggtgtttaaatctttgtgggatcagggcattatc
ttacgtgatcagaataaacaaccctctttaagcggctgcctgcgaattaccgtcggaacc
cgtgaagaaagccagcgcgtcattgacgccttacgtgcggagcaagtttga
              
                            

Download fasta file
RegulonDB