RegulonDB RegulonDB 10.10: Gene Sequence
hisD gene sequence


Size: 1305        A: 286  T: 261  G: 380  C: 378

Fasta

 

>hisD E. coli K12. Version NC_000913.3 GI:556503834
atgagctttaacacaatcattgactggaatagctgtactgcggagcaacaacgccagctg
ttaatgcgcccggcgatttccgcctctgaaagcattacccgcactgttaacgatattctc
gataacgtgaaagcacgcggcgatgaggccctgcgggaatacagcgcgaagtttgataaa
accacggttaccgcgctgaaggtgtctgcagaggagatcgccgccgccagcgaacgcctg
agcgacgagctaaaacaggcgatggcggtggcagtaaagaatattgaaaccttccacact
gcgcaaaaactgccgccggtagatgtagaaacgcagccaggcgtgcgttgccagcaggtc
acgcgtccggtagcttcagttgggttgtatattcctggcggctccgccccgctcttctca
acggtattaatgctggcgactccggcgagtattgcgggctgtaaaaaagtggtgctgtgc
tcaccgccgccgattgccgatgagatcctttatgcggcgcagctgtgcggtgtgcaggac
gtgtttaacgtcggcggcgcacaggccattgccgcactggcgtttggtacggaatctgtg
ccaaaagtggacaaaatcttcgggccgggtaacgcctttgtcaccgaagcgaaacgtcag
gtgagccagcgtctggacggtgcggcgatcgatatgcccgcaggcccgtcggaagtgctg
gtgattgctgacagcggcgctacgccggatttcgtggcttctgatttgctctctcaggct
gaacacggcccggactcacaggtgattttactgacgcccgctgctgatatggcgcgtcgc
gttgccgaggccgtcgaacgccaactggcagaactgccgcgtgccgaaaccgcccgccag
gcactgaacgccagccgcctgatcgtgactaaagatttagcgcagtgcgtggagatctcc
aaccagtacggcccggagcacctgatcattcagacccgcaacgcccgtgaactggtcgat
agcatcaccagcgccggttcggtatttcttggtgactggtcaccggaatcggcaggtgat
tacgcctccggcaccaaccacgttctaccgacttacggttacaccgccacctgttccagc
ctcgggctggcagatttccagaagcgcatgaccgtacaggaactgtcgaaagaggggttc
tccgcgctggcttcaaccatagaaacactggccgccgccgagcgcctgaccgcccacaaa
aatgccgttactttgcgtgttaacgcccttaaggagcaagcatga
              
                            

Download fasta file
RegulonDB