RegulonDB RegulonDB 10.9: Gene Sequence
hisG gene sequence


Size: 900        A: 213  T: 200  G: 244  C: 243

Fasta

 

>hisG E. coli K12. Version NC_000913.3 GI:556503834
atgacagacaacactcgtttacgcatagctatgcagaaatccggccgtttaagtgatgac
tcacgcgaattgctggcgcgctgtggcattaaaattaatcttcacacccagcgcctgatc
gcgatggcagaaaacatgccgattgatattctgcgcgtgcgtgacgacgacattcccggt
ctggtaatggatggcgtggtagaccttgggattatcggcgaaaacgtgctggaagaagag
ctgcttaaccgccgcgcccagggtgaagatccacgctactttaccctgcgtcgtctggat
ttcggcggctgtcgtctttcgctggcaacgccggttgatgaagcctgggacggtccgctc
tccttaaacggtaaacgtatcgccacctcttatcctcacctgctcaagcgttatctcgac
cagaaaggcatctcttttaaatcctgcttactgaacggttctgttgaagtcgccccgcgt
gccggactggcggatgcgatttgcgatctggtttccaccggtgccacgctggaagctaac
ggcctgcgcgaagtcgaagttatctatcgctcgaaagcctgcctgattcaacgcgatggc
gaaatggaagaatccaaacagcaactgatcgacaaactgctgacccgtattcagggtgtg
atccaggcgcgcgaatcaaaatacatcatgatgcacgcaccgaccgaacgtctggatgaa
gtcatcgccctgctgccaggtgccgaacgcccaactattctgccgctggcgggtgaccaa
cagcgcgtagcgatgcacatggtcagcagcgaaaccctgttctgggaaaccatggaaaaa
ctgaaagcgctgggtgccagttcaattctggtcctgccgattgagaagatgatggagtga
              
                            

Download fasta file
RegulonDB