RegulonDB RegulonDB 10.9: Gene Sequence
hisH gene sequence


Size: 591        A: 127  T: 129  G: 175  C: 160

Fasta

 

>hisH E. coli K12. Version NC_000913.3 GI:556503834
atgaacgtggtgatccttgataccggctgcgccaacctgaactcggtgaagtctgccatt
gcgcgtcacggttatgaacccaaagtcagccgtgacccggacgtcgtgttgctggccgat
aaactgtttttacccggcgttggcactgcgcaagcggcgatggatcaggtacgtgagcgc
gagctgtttgatctcatcaaagcctgtacccaaccggtgctgggcatctgcttagggatg
caactgctggggcggcgcagcgaagagagcaacggcgtcgacttgctgggcatcatcgac
gaagacgtgccgaaaatgaccgactttggtctgccactgccacatatgggctggaaccgc
gtttacccgcaggcaggcaaccgcctgtttcaggggattgaagacggcgcgtacttttac
tttgttcacagctacgcaatgccggtcaatccgtggaccatcgcccagtgtaattacggc
gaaccgttcaccgcggcggtacaaaaagataacttctacggcgtgcagttccacccggag
cgttctggtgccgctggtgctaagttgctgaaaaacttcctggagatgtga
              
                            

Download fasta file
RegulonDB