RegulonDB RegulonDB 10.9: Gene Sequence
hisP gene sequence


Size: 774        A: 206  T: 166  G: 225  C: 177

Fasta

 

>hisP E. coli K12. Version NC_000913.3 GI:556503834
atgtccgagaataaattaaacgttatcgatttgcacaaacgctacggcgaacatgaagtg
ctgaaaggggtatcactgcaagcgaatgccggagatgtaataagcatcatcggatcgtcg
ggatcggggaaaagtacctttctgcgctgcattaacttcctcgaaaaaccgagtgaaggg
tcgatcgtggtcaatggccagacgatcaatctggtgcgcgacaaagacggtcaactcaaa
gtcgccgataaaaatcaactgcgcttactgcgcacacgcctgacgatggtattccagcac
ttcaatctctggagccatatgacggtgctggaaaacgtcatggaagcgccgattcaggtg
ttgggcctgagcaagcaggaagcgcgcgagcgggcggtgaagtatctggcaaaagtcggg
atagacgaacgtgcgcaggggaaatatccggtgcatctttccggcggtcagcaacagcgt
gtttctatcgcgcgggcgctggcgatggaaccggaagttttactgtttgatgaacctacc
tcggcgctcgatcctgaactggtaggcgaagtgttgcgtattatgcagcaactggcagaa
gaggggaaaaccatggtggtagtgactcacgaaatgggctttgctcgccatgtttctact
catgtcattttcctccatcaggggaaaatagaagaagagggcgcgccggagcagttattt
ggcaacccgcaaagccctcgtctgcaacggttccttaagggatcgctgaaataa
              
                            

Download fasta file
RegulonDB