RegulonDB RegulonDB 10.9: Gene Sequence
truA gene sequence


Size: 813        A: 189  T: 174  G: 242  C: 208

Fasta

 

>truA E. coli K12. Version NC_000913.3 GI:556503834
atgtccgaccagcaacaaccgccagtttataaaattgcgctgggcattgagtacgacggc
agtaagtattacggctggcaacggcagaacgaagtccgcagtgtgcaggagaagctggaa
aaggcgctctcccaggtggcgaacgaacccatcaccgtcttctgcgccgggcgtactgac
gcaggggtacacggtaccgggcaggttgtgcatttcgaaacaaccgcgctgcgcaaagac
gcggcgtggaccttgggcgtaaatgcgaatttacctggtgacatcgctgtgcgttgggtt
aaaactgtacctgatgattttcatgcccgatttagcgccacggctcgccgttatcgctac
atcatctacaatcatcggctgcgcccggcggtactgagtaaaggggtaacccatttttac
gaaccgctggacgctgaacggatgcatcgggctgcgcaatgcttgctgggcgagaatgat
ttcacctcgttccgtgcggtgcagtgccagtcccgaaccccgtggcgcaacgttatgcat
attaatgtcacgcgtcacggtccttatgtggtggtagatattaaagcgaatgcttttgta
catcatatggtcaggaatattgtcggcagcctgatggaagtcggtgcccacaaccagccg
gagagctggatagcagagttgctggcggcaaaggacagaacgctggcggcagcaacggca
aaagcggaagggctgtatctggtcgcggtggattaccctgaccggtatgatcttccaaaa
ccgccaatgggcccgctatttctggcggactaa
              
                            

Download fasta file
RegulonDB