RegulonDB RegulonDB 10.9: Gene Sequence
hns gene sequence


Size: 414        A: 138  T: 83  G: 100  C: 93

Fasta

 

>hns E. coli K12. Version NC_000913.3 GI:556503834
atgagcgaagcacttaaaattctgaacaacatccgtactcttcgtgcgcaggcaagagaa
tgtacacttgaaacgctggaagaaatgctggaaaaattagaagttgttgttaacgaacgt
cgcgaagaagaaagcgcggctgctgctgaagttgaagagcgcactcgtaaactgcagcaa
tatcgcgaaatgctgatcgctgacggtattgacccgaacgaactgctgaatagccttgct
gccgttaaatctggcaccaaagctaaacgtgctcagcgtccggcaaaatatagctacgtt
gacgaaaacggcgaaactaaaacctggactggccaaggccgtactccagctgtaatcaaa
aaagcaatggatgagcaaggtaaatccctcgacgatttcctgatcaagcaataa
              
                            

Download fasta file
RegulonDB