RegulonDB RegulonDB 10.10: Gene Sequence
htpG gene sequence


Size: 1875        A: 493  T: 391  G: 508  C: 483

Fasta

 

>htpG E. coli K12. Version NC_000913.3 GI:556503834
atgaaaggacaagaaactcgtggttttcagtcagaagtgaaacagcttctgcacctgatg
atccattctctctattccaataaagaaatcttcctgcgtgagcttatctctaacgcctcc
gatgcggcggacaagctgcgtttccgtgcgctctctaacccggacctgtacgaaggtgat
ggcgaactacgcgttcgtgtctctttcgataaagacaagcgtacgctgaccatctccgat
aacggcgtggggatgacccgcgacgaagtgattgaccatctggggactatcgctaaatcc
ggtaccaaatcattcctcgaatccctgggttctgaccaggcgaaagacagccagctgatc
ggtcagtttggtgttggtttctactctgcgtttatcgtggccgacaaagtgaccgtgcgt
actcgcgcggcaggcgaaaaaccagaaaatggcgtcttctgggaatcggctggcgaaggt
gaatacaccgttgccgacatcaccaaagaagatcgtggtactgaaatcaccctgcatctg
cgtgaaggcgaagacgagttcctcgatgactggcgcgtgcgttccatcatcagcaaatac
tccgaccatatcgcgctgccggtagagatcgaaaaacgcgaagagaaagacggcgaaacc
gttatctcctgggagaaaatcaacaaagcgcaggcgctgtggactcgtaacaagtcggaa
atcaccgatgaagagtacaaagagttctacaaacacatcgcccacgactttaatgatccg
ctgacctggagccacaaccgtgttgaaggtaagcaggagtacaccagcctgctgtacatc
ccgtcccaggctccgtgggatatgtggaaccgcgatcataaacacggcctgaaactgtat
gttcagcgtgtgttcatcatggacgacgcagaacagttcatgccgaactatctgcgcttc
gtgcgtggtctgattgactccagcgatctgccgctgaacgtttcccgtgaaatcctccag
gacagcacggtaacgcgtaacctgcgcaatgcgctgaccaagcgtgtgctgcaaatgctg
gaaaaactggcgaaagacgacgcggaaaaataccagaccttctggcaacagtttggcctg
gtactgaaagaaggtccggcggaagatttcgctaaccaggaagcgatcgccaaactgctg
cgttttgcttctacccataccgattcttctgcgcagaccgtatctctggaagactacgtt
tcccgcatgaaagaagggcaggagaaaatctactacatcaccgcagacagctatgcggca
gcgaagagcagcccgcacctggaactgctgcgtaagaaaggcatcgaagttctgctgctt
tccgaccgcatcgatgagtggatgatgaactatctgactgagttcgacggtaaaccgttc
cagtcggtgtctaaagttgacgagtcgcttgaaaaactggctgacgaagttgatgagagc
gcgaaagaagcggagaaagcactgactccgttcatcgaccgtgtgaaagccctgctcggc
gagcgcgtgaaagatgtccgtctgactcaccgtctgaccgatacgccagcgatcgtttcg
accgacgcggacgaaatgagcactcagatggcgaaactgttcgctgcggcgggccagaaa
gtgccagaagtgaaatacatcttcgaactgaacccggatcacgtactggtgaaacgtgcg
gcagatactgaagatgaagcgaagttcagcgagtgggtagaactgctgctggatcaggcg
ctgctggcagaacgcggcacgctggaagatccgaacctgtttattcgtcgtatgaaccag
ctgctggtttcctga
              
                            

Download fasta file
RegulonDB