RegulonDB RegulonDB 10.9: Gene Sequence
htpX gene sequence


Size: 882        A: 191  T: 219  G: 257  C: 215

Fasta

 

>htpX E. coli K12. Version NC_000913.3 GI:556503834
atgatgcgaatcgcgctcttcctgctaacgaacctggccgtaatggtcgttttcgggctg
gtactgagcctgacagggatacagtcgagcagcgttcaggggctgatgatcatggccttg
ctgttcggttttggtggttccttcgtttcgcttctgatgtccaaatggatggcattacga
tctgttggcggggaagtgatcgagcaaccgcgtaacgaaagggaacgttggctggtcaat
actgtagcaacccaggctcgtcaggcggggatcgctatgccgcaagtggctatctaccat
gcgccggacatcaacgcttttgcaaccggtgcgcgccgtgatgcctctctggttgctgtc
agcaccggtttgctgcagaacatgagcccggatgaagccgaggcggtaattgctcacgaa
atcagccacatcgccaatggtgatatggtcaccatgacgctgattcagggcgtggtgaac
accttcgttatctttatttcccgtattctggcgcagcttgccgcgggttttatgggcgga
aatcgtgatgaaggtgaagagagcaacggcaacccgctgatctactttgcggttgcaacg
gttctggaactggtgtttggtattctggcgagcattatcaccatgtggttctcgcgtcat
cgtgaattccatgctgatgccggttcggcaaaactggttggtcgcgagaaaatgattgcc
gcgctgcagcgcctgaaaaccagctatgaaccgcaagaagcaaccagcatgatggctctc
tgcattaacggtaagtcgaaatcgctcagtgagttgttcatgacccacccgccgctggat
aaacgaattgaagctctgcgtacgggtgaatacctgaagtaa
              
                            

Download fasta file
RegulonDB