RegulonDB RegulonDB 10.9: Gene Sequence
degP gene sequence


Size: 1425        A: 356  T: 300  G: 406  C: 363

Fasta

 

>degP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaaccacattagcactgagtgcactggctctgagtttaggtttggcgttatct
ccgctctctgcaacggcggctgagacttcttcagcaacgacagcccagcagatgccaagc
cttgcaccgatgctcgaaaaggtgatgccttcagtggtcagcattaacgtagaaggtagc
acaaccgttaatacgccgcgtatgccgcgtaatttccagcagttcttcggtgatgattct
ccgttctgccaggaaggttctccgttccagagctctccgttctgccagggtggccagggc
ggtaatggtggcggccagcaacagaaattcatggcgctgggttccggcgtcatcattgat
gccgataaaggctatgtcgtcaccaacaaccacgttgttgataacgcgacggtcattaaa
gttcaactgagcgatggccgtaagttcgacgcgaagatggttggcaaagatccgcgctct
gatatcgcgctgatccaaatccagaacccgaaaaacctgaccgcaattaagatggcggat
tctgatgcactgcgcgtgggtgattacaccgtagcgattggtaacccgtttggtctgggc
gagacggtaacttccgggattgtctctgcgctggggcgtagcggcctgaatgccgaaaac
tacgaaaacttcatccagaccgatgcagcgatcaaccgtggtaactccggtggtgcgctg
gttaacctgaacggcgaactgatcggtatcaacaccgcgatcctcgcaccggacggcggc
aacatcggtatcggttttgctatcccgagtaacatggtgaaaaacctgacctcgcagatg
gtggaatacggccaggtgaaacgcggtgagctgggtattatggggactgagctgaactcc
gaactggcgaaagcgatgaaagttgacgcccagcgcggtgctttcgtaagccaggttctg
cctaattcctccgctgcaaaagcgggcattaaagcgggtgatgtgatcacctcactgaac
ggtaagccgatcagcagctttgccgcactgcgtgctcaggtgggtactatgccggtaggc
agcaaactgaccctgggcttactgcgcgacggtaagcaggttaacgtgaacctggaactg
cagcagagcagccagaatcaggttgattccagctccatcttcaacggcattgaaggcgct
gagatgagcaacaaaggcaaagatcagggcgtggtagtgaacaacgtgaaaacgggcact
ccggctgcgcagatcggcctgaagaaaggtgatgtgattattggcgcgaaccagcaggca
gtgaaaaacatcgctgaactgcgtaaagttctcgacagcaaaccgtctgtgctggcactc
aacattcagcgcggcgacagcaccatctacctgttaatgcagtaa
              
                            

Download fasta file
RegulonDB