RegulonDB RegulonDB 11.0: Gene Sequence
lpxL gene sequence


Size: 921        A: 217  T: 216  G: 257  C: 231

Fasta

 

>lpxL E. coli K12. Version NC_000913.3 GI:556503834
atgacgaatctacccaagttctccaccgcactgcttcatccgcgttattggttaacctgg
ttgggtattggcgtactttggttagtcgtgcaattgccctacccggttatctaccgcctc
ggttgtggattaggaaaactggcgttacgttttatgaaacgacgcgcaaaaattgtgcat
cgcaacctggaactgtgcttcccggaaatgagcgaacaagaacgccgtaaaatggtggtg
aagaatttcgaatccgttggcatgggcctgatggaaaccggcatggcgtggttctggccg
gaccgccgaatcgcccgctggacggaagtgatcggcatggaacacattcgtgacgtgcag
gcgcaaaaacgcggcatcctgttagttggcatccattttctgacactggagctgggtgcg
cggcagtttggtatgcaggaaccgggtattggcgtttatcgcccgaacgataatccactg
attgactggctacaaacctggggccgtttgcgctcaaataaatcgatgctcgaccgcaaa
gatttaaaaggcatgattaaagccctgaaaaaaggcgaagtggtctggtacgcaccggat
catgattacggcccgcgctcaagcgttttcgtcccgttgtttgccgttgagcaggctgcg
accacgaccggaacctggatgctggcacggatgtccggcgcatgtctggtgcccttcgtt
ccacgccgtaagccagatggcaaagggtatcaattgattatgctgccgccagagtgttct
ccgccactggatgatgccgaaactaccgccgcgtggatgaacaaagtggtcgaaaaatgc
atcatgatggcaccagagcagtatatgtggttacaccgtcgctttaaaacacgcccggaa
ggcgttccttcacgctattaa
              
                            

Download fasta file
RegulonDB