RegulonDB RegulonDB 10.9: Gene Sequence
hupA gene sequence


Size: 273        A: 83  T: 58  G: 67  C: 65

Fasta

 

>hupA E. coli K12. Version NC_000913.3 GI:556503834
atgaacaagactcaactgattgatgtaattgcagagaaagcagaactgtccaaaacccag
gctaaagctgctctggagtccactctggctgcaattactgagtctctgaaagaaggcgat
gctgtacaactggttggtttcggtaccttcaaagtgaaccaccgcgctgagcgtactggc
cgcaacccgcagaccggtaaagaaatcaaaattgccgcagctaacgtaccggcatttgtt
tctggcaaggcactgaaagacgcagttaagtaa
              
                            

Download fasta file
RegulonDB