RegulonDB RegulonDB 10.9: Gene Sequence
hyaA gene sequence


Size: 1119        A: 252  T: 239  G: 308  C: 320

Fasta

 

>hyaA E. coli K12. Version NC_000913.3 GI:556503834
atgaataacgaggaaacattttaccaggccatgcggcgtcagggcgttacccggcgcagc
tttctcaaatattgtagtctggctgccacgtcgctgggattaggcgcgggaatggcacca
aagattgcctgggcgctggagaacaaaccgcgcattccggtggtatggatccacggtctg
gaatgcacctgctgtaccgaatcttttatccgctccgctcacccactggcgaaggacgtc
atcctttccctgatttccctcgattacgacgatactttgatggctgccgccggaacccag
gcggaagaagtctttgaagacatcatcacgcaatacaatggcaaatatatcctcgcagta
gaaggtaatccgccgctgggcgagcaggggatgttctgtatcagcagcggtcgaccgttt
attgagaaactcaaacgtgccgctgccggagccagcgcgattatcgcctggggaacctgc
gcgtcctggggctgcgtgcaggccgcgcgacccaatccgacgcaggcaacgcctatcgac
aaagtcatcaccgacaaacccattatcaaagtacctggctgcccgccgatcccggatgtg
atgagcgccatcattacttacatggtgacctttgatcgcttgccagatgtcgacagaatg
ggccgtccgctgatgttctatggtcagcgaatccacgataaatgctatcgccgcgcccac
ttcgacgccggagagttcgtccagagttgggatgatgacgctgcccgcaaaggttactgc
ctgtacaaaatgggctgcaaagggcctaccacctataacgcctgttcctccacacgctgg
aatgatggcgtttctttcccaatccagtctggtcacggctgcctgggctgtgcggaaaat
ggtttctgggatcgcggttcgttctacagccgcgtggtcgatattccgcaaatgggtact
cattccaccgccgataccgtcggtttaaccgcgcttggcgtggtggcagcggctgttggt
gtgcacgcagtcgccagcgccgttgaccagcgcagacgtcataaccagcaacctacagaa
accgaacatcagccaggcaatgaggataaacaggcatga
              
                            

Download fasta file
RegulonDB