RegulonDB RegulonDB 10.9: Gene Sequence
hyaB gene sequence


Size: 1794        A: 406  T: 374  G: 505  C: 509

Fasta

 

>hyaB E. coli K12. Version NC_000913.3 GI:556503834
atgagcactcagtacgaaactcagggatacaccatcaataatgccggacgccgcctggtg
gtcgacccgattacgcgcatcgaaggccacatgcgctgcgaagtgaatattaacgatcag
aatgtgatcaccaatgccgtctcctgcggcaccatgtttcgcgggctggagatcatccta
caagggcgcgacccgcgcgatgcgtgggcgttcgttgaacgtatctgcggcgtctgtact
ggcgtacacgccctggcttcggtttacgccatcgaagatgctatcggtattaaagtgccg
gacaacgccaatatcatccgcaacattatgctggcaacgctctggtgccacgatcatctg
gtgcacttctatcagcttgccgggatggactggatcgatgtgttagatgcgctgaaagcc
gacccgcggaaaacctccgaactggcgcaaagtctctcctcttggccgaaatcatcccct
ggctatttcttcgacgtacaaaaccgcctgaaaaaatttgttgaaggcgggcagttgggg
atcttccgcaatggctactgggggcacccgcagtacaaactgccgccagaagctaacctg
atgggctttgcccactatctcgaagctctcgatttccagcgtgaaattgtcaaaatccac
gcggtctttggcggtaaaaacccgcatccaaactggattgtcggcgggatgccttgcgcc
atcaacattgacgaaagcggcgcggtcggggcagtcaatatggaacgcctgaacctggtg
cagtcaattatcacccgcacggcggacttcattaacaacgtgatgatccccgacgcctta
gccatcggtcagttcaacaaaccgtggagcgaaatcggcactggtctttctgataaatgc
gttctcagctacggcgcattcccggatattgccaacgactttggcgagaaaagtctgctg
atgcctggcggcgcggtgattaacggcgacttcaacaatgtgctgccagtggatttggtt
gatccgcagcaggtgcaggagtttgtcgaccacgcctggtatcgatatcccaacgatcag
gtcgggcgtcatccgttcgatggcatcaccgacccgtggtacaaccccggcgatgtcaaa
ggcagcgataccaacattcagcagctgaatgaacaggaacgctactcgtggatcaaagcg
ccacgctggcgcggtaacgcgatggaagtggggccgctggcgcgcacgttaatcgcttat
cacaaaggcgatgctgcgaccgttgagtcggtcgatcgcatgatgtcggcgttgaacctg
ccgctttccggtatccagtcaacgttaggccgcattttgtgccgcgcgcacgaagcgcag
tgggccgcaggtaagttgcagtatttcttcgacaagctgatgaccaacctgaaaaacggc
aatctcgccactgcttccacggaaaaatgggaacctgcaacctggccgacagagtgccgt
ggtgtcggttttaccgaagcgccgcgcggggcgttaggccactgggccgccattcgcgat
ggcaagattgatctctaccagtgcgtggtgccgaccacctggaacgccagcccgcgcgat
cccaaagggcagattggcgcttatgaagcggcgctgatgaacaccaaaatggcgatcccc
gagcaaccgctggagatcctgcgtactctgcacagctttgacccgtgcctcgcctgttca
acacacgtgctgggcgacgacggtagcgagctgatctccgtgcaggtgcgttaa
              
                            

Download fasta file
RegulonDB